Open Access

Performance of “VIKIA Malaria Ag Pf/Pan” (IMACCESS®), a new malaria rapid diagnostic test for detection of symptomatic malaria infections

  • Monidarin Chou1,
  • Saorin Kim2,
  • Nimol Khim2,
  • Sophy Chy2,
  • Sarorn Sum2,
  • Dany Dourng2,
  • Lydie Canier2,
  • Chea Nguon3 and
  • Didier Ménard2Email author
Contributed equally
Malaria Journal201211:295

DOI: 10.1186/1475-2875-11-295

Received: 30 June 2012

Accepted: 15 August 2012

Published: 24 August 2012

Abstract

Background

Recently, IMACCESS® developed a new malaria test (VIKIA Malaria Ag Pf/Pan™), based on the detection of falciparum malaria (HRP-2) and non-falciparum malaria (aldolase).

Methods

The performance of this new malaria rapid diagnostic test (RDT) was assessed using 1,000 febrile patients seeking malaria treatment in four health centres in Cambodia from August to December 2011. The results of the VIKIA Malaria Ag Pf/Pan were compared with those obtained by microscopy, the CareStart Malaria™ RDT (AccessBio®) which is currently used in Cambodia, and real-time PCR (as “gold standard”).

Results

The best performances of the VIKIA Malaria Ag Pf/Pan™ test for detection of both Plasmodium falciparum and non-P. falciparum were with 20–30 min reading times (sensitivity of 93.4% for P. falciparum and 82.8% for non-P. falciparum and specificity of 98.6% for P. falciparum and 98.9% for non-P. falciparum) and were similar to those for the CareStart Malaria™ test.

Conclusions

This new RDT performs similarly well as other commercially available tests (especially the CareStart Malaria™ test, used as comparator), and conforms to the World Health Organization’s recommendations for RDT performance. It is a good alternative tool for the diagnosis of malaria in endemic areas.

Background

Now that artemisinin derivatives in combination with partner drugs (artemisinin combination therapy (ACT)) are being used, parasitological confirmation has become essential before treatment in routine malaria case management, in most countries endemic for malaria[1, 2]. This ensures that anti-malarial drugs are only administered to patients who need them, thereby limiting the unnecessary use of inappropriate treatments. It also minimizes the selection and spread of drug-resistant Plasmodium falciparum parasites[3], particularly important in areas where multidrug resistance is prevalent, such as Southeast Asia[47].

Microscopic examination of blood films still remains the gold standard for malaria diagnosis despite the requirement for high-quality microscopes and equipment, and for qualified personnel[8]. However, over the past two decades, rapid diagnostic tests (RDTs) for malaria have been developed for use in any situation where the only realistic alternative was clinical diagnosis of malaria, for example, at community level (e g, Village Malaria Workers’ strategy in Cambodia). These diagnostic tests are fast and easy to use, and do not require electricity or complex equipment[9]. RDTs are now available from around 60 manufacturers[10]. This profusion of suppliers and the variable quality of RDT products marketed have made it difficult for the policy makers of national malaria control programmes to determine which tests are the most suitable[11]. To address this issue, a global evaluation programme to guide RDT procurement (product testing) and assure RDT performance before and during use in the field (lot testing) was launched in 2002 by the WHO Regional Office of the Western Pacific (WPRO), in collaboration with the WHO/Global Malaria Programme, WHO/GMP), the UNICEF/UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases (TDR), the Foundation for Innovative New Diagnostics (FIND), the Centers for Disease Control and Prevention (CDC, Atlanta) and numerous other partners[12].

The malaria RDTs available are all based on the same principle and like other lateral flow immune-chromatographic tests, there are various formats (dipstick, plastic cassette or card). They contain antibodies conjugated to colloidal gold particles, which bind specifically with parasite antigens. Some of them are specific for P. falciparum and detect the histidine-rich-2 protein (HRP-2). Others combine HRP-2 detection with the detection of antigens common to all species, such as lactate dehydrogenase or aldolase (combo RDTs). Combo RDTs can diagnose infections by P. falciparum or by non-P. falciparum malaria parasites (Plasmodium vivax, Plasmodium ovale and Plasmodium malariae)[13].

IMACCESS© is a company which aims to address public health requirements by developing reliable diagnostic tools responding to the constraints associated with use in the field for populations in developing countries at affordable prices[14]. The company recently developed VIKIA Malaria Ag Pf/Pan™, a new malaria test. This new RDT, based on the same technology as other tests, allows detection of falciparum malaria (HRP-2) and non-falciparum malaria (aldolase).

In this context, the objective of the study presented here was to assess the performances of this new immunochromatographic test by following a conventional field evaluation design including microscopic examination (thick and thin blood film) and molecular detection (real-time PCR) as gold standard methods for malaria diagnosis of febrile, malaria-suspected patients seen at health centre level. In addition, the VIKIA Malaria Ag Pf/Pan™ test was also compared to another RDT widely used in Cambodia and elsewhere (CareStart Malaria™, AccessBio®).

Methods

Rapid diagnostic tests

The VIKIA Malaria Ag Pf/Pan™ test kit (IMACCESS©, Ref. 41 2499, Lot Number: V110727601, Lyon, France), containing one package insert, 25 test cassettes in individual sealed pouches with a disposable specimen pipette and a dessicant and one vial of running lysis buffer, was used according to the manufacturer’s instructions. Briefly, a 5 μL aliquot of blood drawn from patients was added to the sample well. Five drops of lysis buffer were then dispensed into the buffer well (Figure1). Results from the test were interpreted at several times (readings after 10, 15, 20, 30 and 60 min). In parallel, the CareStart Malaria™ test (Access Bio©, Ref. G0131, Lot Number: J191R, New Jersey, USA) was also performed according to the manufacturer’s instructions and used to diagnose patients as malaria infected.
Figure 1

Design of the VIKIA Malaria Ag Pf/Pan™ test.

Study population

Four different sites in Cambodia, all members of the anti-malarial drug-resistance network (collaboration between the Ministry of Health and the Institut Pasteur du Cambodge) were selected (Figure2): Veal Veng health centre (in Pursat province), Veun Sai health centre (in Rattanakiri province), Phnom Dek health centre (in Preah Vihear province) and Takavit health centre (in Sihanoukville province).
Figure 2

Map of Cambodia with the locations of the four selected health centres indicated.

Malaria remains a public health problem at these sites, and is mainly linked to the forests. Forest villagers in the eastern and northern provinces are at high risk of malaria, whereas elsewhere in the country malaria is an occupational disease with particular groups being at high risk, including forestry workers, new settlers and mobile/migrant populations moving into forested areas, and soldiers and their families serving in the forests. The prevalence is between 15% and 40% in villages near or in forested areas, and between 0% and 3% in the plains and rice field areas. The five human Plasmodium species all co-exist in the Cambodia and P. falciparum is the most frequent cause of malaria infections (prevalence ~70%). The distributions of Plasmodium species have been changing over recent years, with a particularly significant increase in the incidence of P. vivax malaria cases (from 8% in 2000 to 23% in 2007). In low transmission areas, a proportion of infections that are P. vivax is commonly up to 50%[1519].

In the four sites, patients with clinical symptoms of malaria (fever ≥37.5°C) and with a prescription for malaria diagnosis from a health care worker, agreeing to be enrolled in the study (by signing the consent form), were included. Pregnant women and patients with signs of severe and complicated P. falciparum malaria according to the definition of the World Health Organization (2001) were excluded[20]. The study protocol was reviewed and approved by the Ethics Committee of the Cambodian Ministry of Health (No. 075 NECHR, 21 June, 2011).

Sample collection

Blood samples were collected by finger-prick and used for malaria testing (both RDTs were tested in parallel by two health staff blinded to each other). In addition, two drops of blood were spotted onto Whatman 3 M filter paper™ and individually stored in an envelope and a plastic bag. Slides for thick and thin microscopic examination were also prepared, and stored in appropriate boxes. Clinical and biological information were recorded on an anonymous form to ensure patient confidentiality. Filter papers and slide boxes were sent to the Institut Pasteur du Cambodge (IPC) in Phnom Penh every week.

Laboratory procedures

At IPC, thick and thin blood smears were stained with 3% Giemsa for 30 min and analysed by light microscopy by two experienced technicians without reference to RDT results. A minimum of 200 consecutive fields was checked in the thick blood film before classifying a slide as negative. Parasites in thick blood films were counted against 200 white blood cells. The parasite density was estimated assuming 8,000 white blood cells/μL of blood. One in 10 slides selected at random, and all slides corresponding to discordance between the first two readings, were read a third time by a third expert microscopist.

DNA was extracted from blood spots with Instagene Matrix resin™ (Bio-Rad©, Marnes la Coquette, France), according to the manufacturer’s instructions. Molecular detection and identification of Plasmodium parasites involved two steps: Plasmodium was detected by a “screening real-time PCR” with primers targeting the Plasmodium cytochrome b gene. Secondly, DNA samples identified as positive for Plasmodium were analysed for malaria species by PCR with several pairs of specific primers (P. falciparum, P. vivax/ Plasmodium knowlesi, P. malariae and P. ovale) targeting the same gene (Table1). Molecular analyses were performed by technicians blind to the results of microscopic and RDT diagnoses.
Table 1

Primers sequences and real-time PCR conditions used to detect Plasmodium species, Cambodia, 2011

Real-time PCR name

Primer name

Sequence (5'-3')

Master mix

Assay parameters

Melt Parameters

T° Melt peak

"Screening"

RTPCRScreening2_F

TGGAGTGGATGGTGTTTTAGA

Hot FirePol EvaGreen qPCR Mix Solis Biodyne 1X (#08- 24-00020), Primers 250 nM, 5 μl DNA template, total volume 20 μl

95°C-15 min. 45 cycles: 95°C-15 sec./60°C-20 sec./ 72°C-20 sec. 95°C-2 min. 68°C-2 min

From 68 to 90°C, increment 0.2°C for 0.05 sec.

76.2 - 78.8°C

RTPCRScreening2_R

TTGCACCCCAATARCTCATTT

Plasmodium sp. identification

Primary PCR

RTPCRScreening2_F

TGGAGTGGATGGTGTTTTAGA

Hot FirePol DNA Pol. Solis BioDyne 1.25 U (#01-02-01000), dNTP 200 μM, MgCl2 2.5 mM, Primers 250 nM, 5 μl DNA template. Total volume 20 μl.

94°C −15 min. 20 cycles: 94°C-30 sec/ 58°C -1 min/ 72°C-1 min3. 72°C-10 min.

N/A

N/A

RTPCRSreening3_R

ACCCTAAAGGATTTGTGCTACC

Pf real-time PCR

Pf_RTPCR_F

ATGGATATCTGGATTGATTTTA TTTATGA

Hot FirePol EvaGreen HRM Mix Solis Biodyne 1X (#08- 33-00001), Primers 250 nM, 5 μl template Primary PCR products 1:1000, total volume 20 μl

95°C-15 min. 40 cycles: 95°C-10 sec./62°C-20 sec./ 72°C-25 sec. 95°C-1 min. 40°C-1 min

From 65 to 90°C, increment 0.2°C for 0.05 sec.

78.8-79.6°C

Pf_RTCPR_R

TCCTCCACATATCCAAATTAC TGC

Pv real-time PCR

Pv_RTPCR_F

TGCTACAGGTGCATCTCTTG TATTC

75.2-76°C

Pv_RTPCR_R

ATTTGTCCCCAAGGTAAAACG

Pm real- time PCR

Pm_RTPCR_F

ACAGGTGCATCACTTGTATTTTTTC

75.8-76.2°C

Pm_RTPCR_R

TGCTGGAATTGAAGATAATAAATT AGTAATAACT

Po real- time PCR

Po_RTPCR_F

GTTATATGGTTATGTGGAGGATA TACTGTT

73.4-74.2°C

Po_RTPCR_R

CGAATGGAAGAATAAAATGTAG TACG

Data analysis

Data were entered, processed, and analysed using Microsoft Excel 2010 software. The chi-squared test was used to compare the performances of the different diagnostic methods used (real-time PCR, microscopy and RDTs). P- values <0.05 indicated statistically significant differences. For sensitivity and specificity, RDT results were compared with microscopy and real-time PCR results. Sensitivity was calculated as the proportion of positive test results obtained among samples containing malaria parasites as identified by microscopy or real-time PCR. Specificity was calculated as the proportion of negative test results among samples scoring negative by thick blood film or real-time PCR tests. Positive and negative predictive values were the proportion of true-positive results among all positive samples and the proportion of true negative results among all negative samples, respectively.

Results

From August to December 2011, 1,000 patients (Preah Vihear, N = 300, Veal Veng, N = 250, Ratanakiri, N = 300 and Takavit, N = 150) with an age range of one to 70 years (mean ± SD age = 22.4 ± 12.9 years; 7.0% <5 years of age, 18.0% between five and 14 years of age, and 75.0% >15 years of age) were recruited. The male/female ratio was 2.1/1. The mean ± SD axillary temperature was 38.1 ± 0.9°C (range = 37.5–41.5°C) and the mean ± SD parasitaemia density was 13,455 ± 52,694 parasites/μL (range = 20–582,500 parasites/μL).

Microscopy results showed that 389 (38.9%) of the 1,000 patients had malaria. Plasmodium falciparum was present in 39.5%, P. vivax in 58.8% and both P. falciparum and P. vivax (mixed infections) in 1.5% of the positive specimens. A total of 92 discordant results (9.2%) were found between microscopy and real-time PCR (Table2). Some 32 cases (3.2%) classified as negative by microscopy were positive by real-time PCR (sub-microscopic parasitaemia: six P. falciparum, six mixed P. falciparum/P. vivax and 21 P. vivax). In addition, 59 samples were misclassified by microscopy: 54 were classified as single infections by microscopy (43 P. falciparum, 11 P. vivax) but found to be mixed infections by real-time PCR (52 mixed P. falciparum/P. vivax and two mixed P. vivax/P. malariae); three cases classified as mixed P. falciparum/P. vivax infections were identified as single P. falciparum infections by real-time PCR; two cases classified as single P. vivax infections were found to be single P. falciparum infections by real-time PCR.
Table 2

Comparison of real-time PCR and microscopy results for 1,000 patients tested for malaria at health centres, Cambodia, 2011

PCR results

Microscopy results

Total

Negative

P. falciparum

P. falciparum/ P. vivax

P. vivax

Negative

578

0

0

0

578

P. falciparum

6

110

3

2

121

P. falciparum/ P. vivax

6

43

4

9

62

P. vivax

21

0

0

216

237

P. vivax/ P malariae

0

0

0

2

2

Total

611

153

7

229

1000

Details concerning patients positive for Plasmodium spp. by real-time PCR, microscopy, CareStart Malaria™ and VIKIA Malaria Ag Pf/Pan™ tests at several reading times (10, 15, 20, 30 and 60 min) are shown in Table3. Frequencies of false positives, false negatives and misclassified results obtained from RDTs with reference to microscopy and PCR results (including non-interpretable data; Table4) indicated that the best reading times were 20–30 min for the VIKIA Malaria Ag Pf/Pan™ test. Diagnostic performances of both RDTs are shown in Table5 and Figure3. Sensitivities for different levels of Plasmodium spp. parasitaemia are summarized in Table6, Figure4 for P. falciparum infections and Figure5 for non-P. falciparum infections.
Table 3

Patients scoring positive for Plasmodium spp. by the reference method (microscopy/PCR), CareStart Malaria™ test and VIKIA Malaria Ag Pf/Pan™ test at several reading times (10, 15, 20, 30 and 60 minutes), Cambodia, 2011.

RDT results

Microscopy and real-time PCR results

Total

  

Negative

Pf

Pf/Pv

Pv

Pv/Pm

 
  

578

121

62

237

2

1000

  

(57.8%)

(12.1%)

(6.2%)

(23.7%)

(0.2%)

(100%)

CareStart Malaria RDT

Negative

570

8

8

33

0

619

Pf & Pf/Non-Pf

3

113

46

6

0

168

Non-Pf

5

0

8

198

2

213

Non interpretable

0

0

0

0

0

0

VIKIA Malaria Ag Pf/Pan RDT - Reading time 10 min.

Negative

574

12

16

89

1

692

Pf & Pf/Non-Pf

1

104

41

3

0

149

Non-Pf

3

3

5

143

1

155

Non interpretable

0

2

0

2

0

4

VIKIA Malaria Ag Pf/Pan RDT - Reading time 15 min.

Negative

573

9

9

54

0

645

Pf & Pf/Non-Pf

2

111

46

4

0

163

Non-Pf

3

1

7

179

2

192

Non interpretable

0

0

0

0

0

0

VIKIA Malaria Ag Pf/Pan RDT - Reading time 20 min.

Negative

570

8

8

44

0

630

Pf & Pf/Non-Pf

2

113

46

6

0

167

Non-Pf

6

0

8

187

2

203

Non interpretable

0

0

0

0

0

0

VIKIA Malaria Ag Pf/Pan RDT - Reading time 30 min.

Negative

570

8

8

40

0

626

Pf & Pf/Non-Pf

2

113

46

6

0

167

Non-Pf

6

0

8

191

2

207

Non interpretable

0

0

0

0

0

0

VIKIA Malaria Ag Pf/Pan RDT - Reading time 60 min.

Negative

567

7

8

40

0

622

Pf & Pf/Non-Pf

5

114

46

7

0

172

Non-Pf

6

0

8

190

2

206

Non interpretable

0

0

0

0

0

0

Pf: P. falciparum; Pv: Plasmodium vivax; Pm: Plasmodium malariae; Non-Pf: Plasmodium non-falciparum.

Table 4

Frequencies of false positive, false negative and misclassified results obtained from RDTs with reference to microscopy and PCR results (including non-interpretable data), Cambodia, 2011

RDTs

Frequency of

Total

False positive

False negative

Misclassified

Non-interpretable

CareStart Malaria RDT

0.8

4.9

1.4

0

7.1

VIKIA Malaria Ag Pf/Pan RDT

Reading time 10 min.

0.4

11.8

1.1

0.4

13.7

Reading time 15 min.

0.5

7.2

1.2

0

8.9

Reading time 20 min.

0.8

6.0

1.4

0

8.2

Reading time 30 min.

0.8

5.6

1.4

0

7.8

Reading time 60 min.

1.1

5.5

1.5

0

8.1

Table 5

Diagnostic performances of the CareStart Malaria™ test and the VIKIA Malaria Ag Pf/Pan™ test at several reading times (10, 15, 20, 30 and 60 min) for detection of Plasmodium spp. in field study patients, Cambodia, 2011

 

RDT diagnostic performance

Sensitivity (95%CI)

Specificity (95%CI)

PPV (95% CI)

NPV (95% CI)

CareStart Malaria RDT

Pf

93.4% (87.4-97.1%)

98.6% (97.3-99.40%)

93.4% (87.4-97.10%)

98.6% (97.3-99.4%)

Non-Pf

85.8% (80.7-90.0%)

99.1% (98.0-99.7%)

97.6% (94.4-99.2%)

94.5% (92.4-96.2%)

VIKIA Malaria Ag Pf/Pan RDT - Reading time 10 min.

Pf

89.7% (82.6-94.6%)

99.3% (98.3-99.8%)

96.3% (90.8-99.0%)

97.9% (96.4-98.9%)

Non-Pf

61.5% (54.9-67.8%)

99.5% (98.5-99.9%)

97.9% (94.1-99.6%)

86.4% (83.6-89.0%)

VIKIA Malaria Ag Pf/Pan RDT - Reading time 15 min.

Pf

92.5% (86.2-96.5%)

99.1% (98.0-99.7%)

95.7% (90.2-98.6%)

98.4% (97.1-99.3%)

Non-Pf

77.0% (71.1-82.2%)

99.5% (98.5-99.9%)

98.4% (95.3-99.7%)

91.4% (88.9-93.5%)

VIKIA Malaria Ag Pf/Pan RDT - Reading time 20 min.

Pf

93.4% (87.4-97.1%)

98.6% (97.3-99.40%)

93.4% (87.4-97.10%)

98.6% (97.3-99.4%)

Non-Pf

81.1% (75.5-85.9%)

98.9% (97.7-99.6%)

96.9% (93.4-98.9%)

92.8% (90.5-94.7%)

VIKIA Malaria Ag Pf/Pan RDT - Reading time 30 min.

Pf

93.4% (87.4-97.1%)

98.6% (97.3-99.40%)

93.4% (87.4-97.10%)

98.6% (97.3-99.4%)

Non-Pf

82.8% (77.4-87.4%)

98.9% (97.7-99.6%)

97.0% (93.6-98.9%)

93.4% (91.2-95.3%)

VIKIA Malaria Ag Pf/Pan RDT - Reading time 60 min.

Pf

94.2% (88.4-97.6%)

98.1% (96.6-99.0%)

91.2% (84.8-95.5%)

98.8% (97.5-99.5%)

Non-Pf

82.7% (77.3-87.4%)

98.9% (97.7-99.6%)

97.0% (93.5-98.9%)

93.4% (91.1-95.2%)

Pf: P. falciparum; Non-Pf: Plasmodium non-falciparum.

PPV: Positive predictive value; NPV: Negative predictive value.

Figure 3

Comparative representation of the diagnostic performances of the CareStart Malaria™ test and the VIKIA Malaria Ag Pf/Pan™ test at several reading times (10, 15, 20, 30 and 60 minutes) for detection of Plasmodium spp. in field study patients, Cambodia, 2011.

Table 6

Diagnostic performance of the CareStart Malaria™ test and the VIKIA Malaria Ag Pf/Pan™ test at several reading times (10, 15, 20, 30 and 60 minutes) for different levels of Plasmodium spp. parasitaemia, Cambodia, 2011

Parasitaemia/μl of blood

CareStart Malaria RDT

VIKIA Malaria Ag Pf/Pan RDT - Reading time 10 min.

VIKIA Malaria Ag Pf/Pan RDT - Reading time 15 min.

Pf

Non-Pf

Pf

Non-Pf

Pf

Non-Pf

Sub-microscopic

Sensitivity

16.7%

0.0%

16.7%

0.0%

16.7%

0.0%

< 100

Sensitivity

75.0%

68.7%

75.0%

46.7%

75.0%

50.0%

101-500

Sensitivity

71.4%

80.9%

57.1%

36.4%

57.1%

45.5%

501-1,000

Sensitivity

100.0%

72.7%

90.0%

36.4%

100.0%

72.7%

1,001-5,000

Sensitivity

100.0%

100.0%

100.0%

72.0%

100.0%

88.2%

5,001-10,000

Sensitivity

100.0%

100.0%

90.5%

74.3%

100.0%

92.1%

10,001-50,000

Sensitivity

100.0%

100.0%

100.0%

77.9%

100.0%

98.5%

50,001-100,000

Sensitivity

100.0%

100.0%

100.0%

100.0%

100.0%

100.0%

> 100,000

Sensitivity

100.0%

-

95.5%

-

100.0%

-

Parasitaemia/μl of blood

VIKIA Malaria Ag Pf/Pan RDT - Reading time 20 min.

VIKIA Malaria Ag Pf/Pan RDT - Reading time 30 min.

VIKIA Malaria Ag Pf/Pan RDT - Reading time 60 min.

Pf

Non-Pf

Pf

Non-Pf

Pf

Non-Pf

Sub-microscopic

Sensitivity

16.7%

0.0%

16.7%

0.0%

16.7%

0.0%

< 100

Sensitivity

75.0%

53.3%

75.0%

53.3%

75.0%

56.2%

101-500

Sensitivity

71.4%

57.1%

71.4%

61.9%

85.7%

61.9%

501-1,000

Sensitivity

100.0%

72.7%

100.0%

81.8%

100.0%

81.8%

1,001-5,000

Sensitivity

100.0%

94.0%

100.0%

98.0%

100.0%

98.0%

5,001-10,000

Sensitivity

100.0%

97.4%

100.0%

97.4%

100.0%

97.4%

10,001-50,000

Sensitivity

100.0%

100.0%

100.0%

100.0%

100.0%

100.0%

50,001-100,000

Sensitivity

100.0%

100.0%

100.0%

100.0%

100.0%

100.0%

> 100,000

Sensitivity

100.0%

-

100.0%

-

100.0%

-

Pf: P. falciparum; Non-Pf: Plasmodium non-falciparum.

Figure 4

Comparative representation of the sensitivities of the CareStart Malaria™ test and the VIKIA Malaria Ag Pf/Pan™ test at several reading times (10, 15, 20, 30 and 60 minutes) for different levels of Plasmodium spp. parasitaemia. Results for Plasmodium falciparum infections, Cambodia, 2011.

Figure 5

Comparative representation of the sensitivities of the CareStart Malaria™ test and the VIKIA Malaria Ag Pf/Pan™ test at several reading times (10, 15, 20, 30 and 60 minutes) for different levels of Plasmodium spp. parasitaemia. Results for non-P. falciparum infections, Cambodia, 2011.

Discussion

This study reports the first evaluation of the performance of the VIKIA Malaria Ag Pf/Pan™, a new immunochromatographic test developed by IMACCESS®, using a combination of microscopy and real-time PCR as reference methods for classification of samples. This approach had the advantage of combining the high sensitivity (especially at low parasite density) and specificity (to correctly identify the parasite species) of real-time PCR, with the possibility of estimating parasite density by microscopy. As expected, more positive samples were found using real-time PCR than microscopy (+ 8.5%, 38.9% vs 42.2%), CareStart Malaria™ test (+9.7%, 38.1% vs 42.2%) or VIKIA Malaria Ag Pf/Pan™ test (from +10.4% for 60 min reading time to +27.0% for 10 min reading time, 30.8% and 37.8%, respectively vs 42.2%). A similar trend was also found for a greater sensitivity of microscopy by expert microscopists than malaria RDTs: 2.0% more positive samples by microscopy than CareStart Malaria™ test (38.8% vs 38.1%) and 2.8% (60 min reading time) to 20.8% (10 min reading time) more than with the VIKIA Malaria Ag Pf/Pan™ test (38.8% vs 37.8% and 30.8%, respectively).

The sensitivity (and the frequency of false negatives) of the VIKIA Malaria Ag Pf/Pan™ test increased with reading time, from 89.7% for P. falciparum detection and 61.5% for non-P. falciparum detection (10 min) to 94.2% for P. falciparum detection and 82.7% for non-P. falciparum detection (60 min). The specificity (and the frequency of false positives) decreased with reading time from 99.3% for P. falciparum detection and 99.5% for non-P. falciparum detection (10 min) to 98.1% for P. falciparum detection and 98.9% for non-P. falciparum detection (60 min).

The best performances of the VIKIA Malaria Ag Pf/Pan™ test for both P. falciparum and non-P. falciparum detection were observed at 20–30 min (sensitivity: 93.4% for P. falciparum and 81.1%-82.8% for non-P. falciparum; specificity: 98.6% for P. falciparum and 98.9% for non-P. falciparum). Using these reading times, the performance of the VIKIA Malaria Ag Pf/Pan™ test was similar to those of the CareStart Malaria™ test or those found in previous studies[2126].

Moreover, as has been previously reported, the sensitivities of both malaria RDT decreased with the level of the parasitaemia[23, 2630]: for P. falciparum, the sensitivity of the both tests started to decrease at levels of parasitaemia < 500 parasites/μL (100% above 500 parasites/μL) and for non-P. falciparum, the sensitivity of the CareStart Malaria™ test and the VIKIA Malaria Ag Pf/Pan™ test started to decrease below 1,000 parasites/μL or below 10,000 parasites/μL, respectively. False negative results for both malaria RDT were only found in P. falciparum samples containing <250 parasites/μL and in non-P. falciparum samples with <1,000 parasites/μL.

According to WHO recommendations for RDT performances[31], sensitivity of the VIKIA Malaria Ag Pf/Pan™ test (except when the time reading was 10 min) was greater than 95%, excluding samples with a parasitaemia <100 parasites/μL. As observed for the CareStart Malaria™ test, the VIKIA Malaria Ag Pf/Pan™ test was easy to use and interpret and simple to store with no cold chain requirement.

Conclusions

In conclusion, this new RDT performs similarly well as other commercially available tests (and in particular the CareStart Malaria™ test, used as comparator), and conforms to WHO recommendations for RDT performance. It appears to be a satisfactory alternative tool for the diagnosis of malaria in endemic areas.

Notes

Declarations

Acknowledgments

We thank everyone at Veal Veng, Veun Sai, Phnom Dek and Takavit health centres for participating in the study. We also thank all the health workers and the staff of the Ministry of Health of Cambodia and the National Center for Parasitology, Entomology and Malaria Control for their collaboration. We are grateful to Marc Leportier, Catherine Ratat and Anne Bertrand-Pinault from IMACCESS for providing VIKIA Malaria Ag Pf/Pan™ test kits and for their constructive advice. We also thank Prof Stéphane Picot from Lyon Malaria Research Unit for sending blood spots used for checking the quality of the real-time PCR.

This study was supported by IMACCESS. The fund providers had no role in data collection and analysis, decision to publish, or preparation of the manuscript. Didier Ménard is supported by the French Ministry of Foreign Affairs.

Authors’ Affiliations

(1)
Faculty of Pharmacy, Université des Sciences de la Santé
(2)
Malaria Molecular Epidemiology Unit, Institut Pasteur du Cambodge
(3)
National Center for Parasitology, Entomology and Malaria Control

References

  1. WHO: World Malaria Report. 2008, http://www.who.int/malaria/publications/atoz/9789241563697/en/index.html. Accessed 20 June 2012Google Scholar
  2. WHO: Guidelines for the Treatment of Malaria. 2010, Geneva: World Health OrganizationGoogle Scholar
  3. WHO: Antimalarial drug combination therapy. Report of a WHO technical consultation. 2001, Geneva: World Health OrganizationGoogle Scholar
  4. Dondorp AM, Fairhurst RM, Slutsker L, Macarthur JR, Breman JG, Guerin PJ, Wellems TE, Ringwald P, Newman RD, Plowe CV: The threat of artemisinin-resistant malaria. N Engl J Med. 2011, 365: 1073-1075. 10.1056/NEJMp1108322.PubMed CentralView ArticlePubMedGoogle Scholar
  5. Dondorp AM, Nosten F, Yi P, Das D, Phyo AP, Tarning J, Lwin KM, Ariey F, Hanpithakpong W, Lee SJ, Ringwald P, Silamut K, Imwong M, Chotivanich K, Lim P, Herdman T, An SS, Yeung S, Singhasivanon P, Day NP, Lindegardh N, Socheat D, White NJ: Artemisinin resistance in Plasmodium falciparum malaria. N Engl J Med. 2009, 361: 455-467. 10.1056/NEJMoa0808859.PubMed CentralView ArticlePubMedGoogle Scholar
  6. Dondorp AM, Yeung S, White L, Nguon C, Day NP, Socheat D, von Seidlein L: Artemisinin resistance: current status and scenarios for containment. Nat Rev Microbiol. 2011, 8: 272-280.Google Scholar
  7. Phyo AP, Nkhoma S, Stepniewska K, Ashley EA, Nair S, McGready R, Ler Moo C, Al-Saai S, Dondorp AM, Lwin KM, Singhasivanon P, Day NP, White NJ, Anderson TJ, Nosten F: Emergence of artemisinin-resistant malaria on the western border of Thailand: a longitudinal study. Lancet. 2012, 379: 1960-1966. 10.1016/S0140-6736(12)60484-X.PubMed CentralView ArticlePubMedGoogle Scholar
  8. Moody A: Rapid diagnostic tests for malaria parasites. Clin Microbiol Rev. 2002, 15: 66-78. 10.1128/CMR.15.1.66-78.2002.PubMed CentralView ArticlePubMedGoogle Scholar
  9. Murray CK, Bell D, Gasser RA, Wongsrichanalai C: Rapid diagnostic testing for malaria. Trop Med Int Health. 2003, 8: 876-883. 10.1046/j.1365-3156.2003.01115.x.View ArticlePubMedGoogle Scholar
  10. Bell D, Perkins MD: Making malaria testing relevant: beyond test purchase. Trans R Soc Trop Med Hyg. 2008, 102: 1064-1066. 10.1016/j.trstmh.2008.05.007.View ArticlePubMedGoogle Scholar
  11. Bell D, Wongsrichanalai C, Barnwell JW: Ensuring quality and access for malaria diagnosis: how can it be achieved?. Nat Rev Microbiol. 2006, 4: 682-695. 10.1038/nrmicro1474.View ArticlePubMedGoogle Scholar
  12. FIND: Fondation for Innovative New Diagnostics. http://www.finddiagnostics.org/programs/malaria/find_activities/rdt_quality_control/. Accessed 20 June 2012
  13. Bell D, Peeling RW: Evaluation of rapid diagnostic tests: malaria. Nat Rev Microbiol. 2006, 4: S34-S38. 10.1038/nrmicro1524.View ArticlePubMedGoogle Scholar
  14. IMACCESS. http://www.imaccess.org/. Accessed 20 June 2012
  15. Steenkeste N, Rogers WO, Okell L, Jeanne I, Incardona S, Duval L, Chy S, Hewitt S, Chou M, Socheat D, Babin FX, Ariey F, Rogier C: Sub-microscopic malaria cases and mixed malaria infection in a remote area of high malaria endemicity in Rattanakiri province, Cambodia: implication for malaria elimination. Malar J. 2010, 9: 108-10.1186/1475-2875-9-108.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Steenkeste N, Incardona S, Chy S, Duval L, Ekala MT, Lim P, Hewitt S, Sochantha T, Socheat D, Rogier C, Mercereau-Puijalon O, Fandeur T, Ariey F: Towards high-throughput molecular detection of Plasmodium: new approaches and molecular markers. Malar J. 2009, 8: 86-10.1186/1475-2875-8-86.PubMed CentralView ArticlePubMedGoogle Scholar
  17. Incardona S, Vong S, Chiv L, Lim P, Nhem S, Sem R, Khim N, Doung S, Mercereau-Puijalon O, Fandeur T: Large-scale malaria survey in Cambodia: novel insights on species distribution and risk factors. Malar J. 2007, 6: 37-10.1186/1475-2875-6-37.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Khim N, Siv S, Kim S, Mueller T, Fleischmann E, Singh B, Divis PC, Steenkeste N, Duval L, Bouchier C, Duong S, Ariey F, Menard D: Plasmodium knowlesi infection in humans, Cambodia, 2007–2010. Emerg Infect Dis. 2011, 17: 1900-1902. 10.3201/eid1710.110355.PubMed CentralView ArticlePubMedGoogle Scholar
  19. WHO: Malaria morbidity and mortality by province in Cambodia. 2011, Geneva: World Health OrganizationGoogle Scholar
  20. World Health Organization: Severe falciparum malaria. Trans R Soc Trop Med Hyg. 2000, 94: S1-S90.View ArticleGoogle Scholar
  21. Grobusch MP, Hanscheid T, Gobels K, Slevogt H, Zoller T, Rogler G, Teichmann D: Comparison of three antigen detection tests for diagnosis and follow-up of falciparum malaria in travellers returning to Berlin, Germany. Parasitol Res. 2003, 89: 354-357.PubMedGoogle Scholar
  22. Hopkins H, Bebell L, Kambale W, Dokomajilar C, Rosenthal PJ, Dorsey G: Rapid diagnostic tests for malaria at sites of varying transmission intensity in Uganda. J Infect Dis. 2008, 197: 510-518. 10.1086/526502.View ArticlePubMedGoogle Scholar
  23. Hopkins H, Kambale W, Kamya MR, Staedke SG, Dorsey G, Rosenthal PJ: Comparison of HRP2- and pLDH-based rapid diagnostic tests for malaria with longitudinal follow-up in Kampala, Uganda. Am J Trop Med Hyg. 2007, 76: 1092-1097.PubMedGoogle Scholar
  24. Rakotonirina H, Barnadas C, Raherijafy R, Andrianantenaina H, Ratsimbasoa A, Randrianasolo L, Jahevitra M, Andriantsoanirina V, Menard D: Accuracy and reliability of malaria diagnostic techniques for guiding febrile outpatient treatment in malaria-endemic countries. Am J Trop Med Hyg. 2008, 78: 217-221.PubMedGoogle Scholar
  25. Playford EG, Walker J: Evaluation of the ICT malaria P.f/P.v and the OptiMal rapid diagnostic tests for malaria in febrile returned travellers. J Clin Microbiol. 2002, 40: 4166-4171. 10.1128/JCM.40.11.4166-4171.2002.PubMed CentralView ArticlePubMedGoogle Scholar
  26. Ratsimbasoa A, Fanazava L, Radrianjafy R, Ramilijaona J, Rafanomezantsoa H, Menard D: Evaluation of two new immunochromatographic assays for diagnosis of malaria. Am J Trop Med Hyg. 2008, 79: 670-672.PubMedGoogle Scholar
  27. Forney JR, Magill AJ, Wongsrichanalai C, Sirichaisinthop J, Bautista CT, Heppner DG, Miller RS, Ockenhouse CF, Gubanov A, Shafer R, DeWitt CC, Quino-Ascurra HA, Kester KE, Kain KC, Walsh DS, Ballou WR, Gasser RA: Malaria rapid diagnostic devices: performance characteristics of the ParaSight F device determined in a multisite field study. J Clin Microbiol. 2001, 39: 2884-2890. 10.1128/JCM.39.8.2884-2890.2001.PubMed CentralView ArticlePubMedGoogle Scholar
  28. Forney JR, Wongsrichanalai C, Magill AJ, Craig LG, Sirichaisinthop J, Bautista CT, Miller RS, Ockenhouse CF, Kester KE, Aronson NE, Andersen EM, Quino-Ascurra HA, Vidal C, Moran KA, Murray CK, DeWitt CC, Heppner DG, Kain KC, Ballou WR, Gasser RA: Devices for rapid diagnosis of Malaria: evaluation of prototype assays that detect Plasmodium falciparum histidine-rich protein 2 and a Plasmodium vivax-specific antigen. J Clin Microbiol. 2003, 41: 2358-2366. 10.1128/JCM.41.6.2358-2366.2003.PubMed CentralView ArticlePubMedGoogle Scholar
  29. Pattanasin S, Proux S, Chompasuk D, Luwiradaj K, Jacquier P, Looareesuwan S, Nosten F: Evaluation of a new Plasmodium lactate dehydrogenase assay (OptiMAL-IT) for the detection of malaria. Trans R Soc Trop Med Hyg. 2003, 97: 672-674. 10.1016/S0035-9203(03)80100-1.View ArticlePubMedGoogle Scholar
  30. Ratsimbasoa A, Randriamanantena A, Raherinjafy R, Rasoarilalao N, Menard D: Which malaria rapid test for Madagascar? Field and laboratory evaluation of three tests and expert microscopy of samples from suspected malaria patients in Madagascar. Am J Trop Med Hyg. 2007, 76: 481-485.PubMedGoogle Scholar
  31. The Use of Malaria Rapid Diagnostic Tests. http://www.searo.who.int/LinkFiles/Malaria_in_the_SEAR_RDTGuidelines_final1.pdf. 20 June 2012

Copyright

© Chou et al.; licensee BioMed Central Ltd. 2012

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Advertisement