Open Access

Limited polymorphism in Plasmodium falciparum ookinete surface antigen, von Willebrand factor A domain-related protein from clinical isolates

  • Jack S Richards1Email author,
  • Nicholas J MacDonald2 and
  • Damon P Eisen1
Malaria Journal20065:55

DOI: 10.1186/1475-2875-5-55

Received: 26 April 2006

Accepted: 05 July 2006

Published: 05 July 2006

Abstract

Background

As malaria becomes increasingly drug resistant and more costly to treat, there is increasing urgency to develop effective vaccines. In comparison to other stages of the malaria lifecycle, sexual stage antigens are under less immune selection pressure and hence are likely to have limited antigenic diversity.

Methods

Clinical isolates from a wide range of geographical regions were collected. Direct sequencing of PCR products was then used to determine the extent of polymorphisms for the novel Plasmodium falciparum sexual stage antigen von Willebrand Factor A domain-related Protein (PfWARP). These isolates were also used to confirm the extent of diversity of sexual stage antigen Pfs28.

Results

PfWARP was shown to have non-synonymous substitutions at 3 positions and Pfs28 was confirmed to have a single non-synonymous substitution as previously described.

Conclusion

This study demonstrates the limited antigenic diversity of two prospective P. falciparum sexual stage antigens, PfWARP and Pfs28. This provides further encouragement for the proceeding with vaccine trials based on these antigens.

Background

Development of effective Plasmodium falciparum vaccines is a global health priority with all stages of the malaria lifecycle being investigated for possible vaccine strategies [1]. Mosquito-stage vaccines aim to induce immunity to the forms of the parasite found in the mid-gut of mosquitoes: the sexual stage macro- and microgametes and the post-fertilization zygotes and ookinetes. Antibodies that target antigens in these stages prevent infection in the mosquito thus breaking the transmission cycle. Since malaria transmission is both highly localized and focal [2], such vaccines may form a useful element as part of integrated control programmes to locally eliminate or substantially reduce transmission. They may also have a useful role in conjunction with chemotherapeutic agents to prevent drug-resistant or vaccine-escape mutants.

The P. falciparum, mosquito-stage vaccine candidate antigens include Pfs25, Pfs28, Pfs48/45, Pfs230 and the recently described, von Willebrand factor A domain-related protein (PfWARP) [3, 4]. PfWARP (PF08_0136b) is located on chromosome 8 (GenBank: NC_004329 Region: 1221207...1222079) and encodes a 290 amino acid protein. On the basis of previous study of orthologues in Plasmodium berghei and Plasmodium gallinaceum, PfWARP is thought to be a soluble micronemal protein expressed in the late ookinete and early oocyst [57]. It is proposed that the von Willebrand factor A domains found in PfWARP and other malaria antigens, including circumsporozoite protein and thrombospondin-related anonymous protein have a role as an adhesive substrate and may assist in host cell invasion [7, 8].

Pfs28 (PF10_0302) is a lead candidate for a transmission-blocking vaccine. It is a 28-kDa protein and is presumably anchored to parasite surface by glycosylphosphatidylinositol [9]. It is encoded on chromosome 10 and shares putative functional determinants with Pfs25. Pfs28 is expressed on the surface of late ookinetes of P. falciparum and it is proposed that it is involved in adherence to the mosquito's gut epithelium [10]. Previous studies have examined Pfs28 polymorphism in laboratory isolates Dd2, 2D11, CAMP, LE5, LF4, HB3, 7G8 [11] and from 32 field isolates from a geographically restricted region in the Philippines [12]. These have shown the presence of a single non-synonymous A274G base substitution, resulting in a conservative amino acid change from lysine to arginine (GenBank: L25843).

As part of the assessment of PfWARP's suitability as a vaccine candidate, the diversity in this gene was assessed using P. falciparum field isolates from a range of geographic locations. In addition, Pfs28 was sequenced in the same isolates to extend previous observations of its' diversity.

Methods

Review and approval of the study was obtained from the Research Ethics Committee of the Royal Brisbane Hospital and the Melbourne Health Human Research Ethics Committee. Clinical samples from P. falciparum-infected patients were obtained from the Malaria Reference Laboratory at the Royal Brisbane Hospital, Queensland. Twenty-two samples were studied from unrelated travellers returning from Papua New Guinea, Solomon Islands, Pakistan, Kenya, Tanzania, Uganda, Zimbabwe, and Ghana.

Whole blood specimens were stored in 8 M guanidine hydrochloride/0.1 M Na H2PO4. Genomic DNA was isolated from the samples using the QIAquick® PCR purification kit (Qiagen, Hilden, Germany). PfWARP and Pfs28 polymorphism was assessed using PCR conditions as outlined (Table 1). All PCR reactions used Amplitaq Gold® DNA polymerase (Roche Diagnostics, Mannheim, Germany). PCR products were detected after submarine electrophoresis using 1% agarose gel stained with ethidium bromide. PCR products were purified for direct sequencing using QIAquick® PCR purification kit (Qiagen, Hilden, Germany) or were agarose gel purified using MinElute Gel extraction kit® (Qiagen, Hilden, Germany) purification kit. DNA sequencing was performed utilising the automated 3100 Genetic Analyser capillary system. In addition, samples with multiple infections of P. falciparum were detected by merozoite surface protein 2 (MSP2) PCR as previously described [13]. Amplification of this highly polymorphic gene allowed rapid detection of size separable fragments by gel electrophoresis.
Table 1

Details of primers, primer and MgCl2 concentrations and cycle conditions for the amplification of PfWARP and Pfs28 genes. Oligonucleotide positions are based on NCBI Genebank sequence PfWARP (NC_004329) and Pfs28 (L25843).

Oligonucleotide

Nucleotide sequence

Description

Primer (μM)/MgCl2 (mM)

Cycle conditions

PfWARP_USF

GTTGTTGTATAATAAGAGAGAGAAAAATG

WARP bases 1221181 to 1221209

0.6/2.0

94°C 10 min (94°C 30 sec, 52°C 30 sec, 72°C 60 sec) 40 cycles, 72°C 5 min

PfWARP_IR

TACATCTTATGATTTATTCTTATCACATA

WARP bases 1222057 to 1222085

  

PfWARP_IF

GTGGTATTATGTTTGGGTATGATATCAGC

WARP bases 1221222 to 1221250

0.6/1.5

94°C 10 min (94°C 30 sec, 52°C 30 sec, 72°C 60 sec) 25 cycles, 72°C 5 min

PfWARP_IR

TACATCTTATGATTTATTCTTATCACATA

WARP bases 1222057 to 1222085

  

Pfs28_F1

ATGAATACATATTTTAAGGTACTTCTT

Pfs28 bases 60 to 86

1.0/2.5

94°C 10 min (94°C 60 sec, 46°C 60 sec, 72°C 45 sec) 40 cycles, 72°C 10 min

Pfs28_R650

GAGCATACAATCAGAACGTGTGTTAGG

Pfs28 bases 680 to 709

  

Pfs28_F40

CAACTTTACATAACGTTGAATAAGGCTC

Pfs28 bases 99 to 126

1.0/2.5

94°C 10 min (94°C 60 sec, 50°C 60 sec, 72°C 45 sec) 34 cycles, 72°C 10 min

Pfs28_R630

GCATACAATCAGAACGTGTGTTAG

Pfs28 bases 666 to 689

  

Results

PfWARP was amplified from 19 of the field samples and three laboratory strains (3D7, FC27, and FCR3). As judged by MSP2 genotyping, there were multiple infections in 7 of the 19 patient samples. These 7 patient samples had a minimum of 26 genetically different clones of P. falciparum. However, direct sequencing of PCR products from each of these samples showed only a single genotype of PfWARP with no mixed peaks in the sequencing traces. Non-synonymous nucleotide substitutions were found to occur in three positions amongst the variant sequences. No synonymous substitutions were identified. The predicted amino acid changes were conservative and contained within the single Von Willebrand factor domain (Table 2). Sample numbers were insufficient to determine whether there was any geographic distribution to the PfWARP alleles.
Table 2

Details of PfWARP and Pfs28 polymorphisms and geographic origin for each isolate

Isolate number

Geographic origina

PfsWARP sequenceb

Pfs28 sequencec

Nucleotide sequence 1221576–1221581

Nucleotide sequence 1221645–1221650

Nucleotide sequence 1221885–1221890

Nucleotide sequence 270–275

3D7

Netherlands

GTCT TT

GTAG TC

CAAA CA

TTTAA A

FC27

Papua New Guinea

GTCC TT

GTAT TC

CAAG CA

Xd

FCR3

Central/South America

GTCC TT

GTAT TC

CAAG CA

Xd

1

Uganda

GTCT TT

GTAC TC

CAAA CA

TTTAA A

2

Papua New Guinea

GTCC TT

GTAT TC

CAAG CA

TTTAG A

3

Papua New Guinea

GTCC TT

GTAT TC

CAAG CA

TTTAG A

4

Ivory Coast

GTCT TT

GTAT TG

CAAA CA

Xd

5

Papua New Guinea

GTCC TT

GTAT TC

CAAG CA

TTTAG A

6

Papua New Guinea

GTCC TT

GTAT TC

CAAG CA

Xd

7

Tanzania

GTCC TT

GTAT TC

CAAG CA

TTTAG A

8

Tanzania

GTCC TT

GTAT TC

CAAG CA

TTTAA A

9

Papua New Guinea

GTCC TT

GTAT TC

CAAG CA

Xd

10

Solomon Islands

GTCC TT

GTAT TC

CAAG CA

TTTAG A

11

Ghana

GTCT TT

GTAT TG

CAAA CA

TTTAA A

12

Papua New Guinea

GTCC TT

GTAT TC

CAAG CA

TTTAG A

13

Papua New Guinea

GTCT TT

GTAG TC

CAAA CA

TTTAG A

14

Papua New Guinea

GTCT TT

GTAT TG

CAAG CA

TTTAA A

15

Pakistan

GTCC TT

GTAT TC

CAAG CA

TTTAG A

16

Papua New Guinea

GTCC TT

GTAT TC

CAAG CA

TTTAG A

17

Papua New Guinea

GTCC TT

GTAT TC

CAAG CA

TTTAG A

18

Kenya

GTCT TT

GTAG TC

CAAA CA

TTTAA A

19

Papua New Guinea

GTCC TT

GTAT TC

CAAG CA

TTTAA A

20

Papua New Guinea

Xd

Xd

Xd

TTTAG A

21

Togo

Xd

Xd

Xd

TTTAA A

22

Papua New Guinea

Xd

Xd

Xd

TTTAA A

23

Tanzania

Xd

Xd

Xd

TTTAA A

24

Zimbabwe

Xd

Xd

Xd

TTTAA A

25

Ghana

Xd

Xd

Xd

TTTAA A

CAMPe

SE Asia

Xd

Xd

Xd

TTTAA A

LE5e

Africa

Xd

Xd

Xd

TTTAA A

LF4e

Africa

Xd

Xd

Xd

TTTAA A

HB3e

Central/South America

Xd

Xd

Xd

TTTAA A

7G8e

Central/South America

Xd

Xd

Xd

TTTAA A

Dd2e

SE Asia

Xd

Xd

Xd

TTTAG A

2D11e

SE Asia

Xd

Xd

Xd

TTTAG A

2 Philippine isolatese

SE Asia

Xd

Xd

Xd

TTTAA A

30 Philippine isolatese

SE Asia

Xd

Xd

Xd

TTTAG A

a The precise geographic origin of laboratory parasite strains is unclear in some instances

b Variable nucleotide positions for PfWARP are indicated in bold (GenBank: NC_004329 Region: 1221207...1222079).

c Variable nucleotide positions for Pfs28 are indicated in bold (GenBank: L25843).

d The symbol "X" is used to indicate that the isolate was not tested.

e Theses isolates, laboratory strains and their geographic origin are cited as given in the paper by Hafalla et al [12].

Pfs28 was amplified in 22 field samples (representing at least 31 clones due to the existence of multiple MSP2 alleles in nine patients) and in 3D7. The A274G, non-synonymous, nucleotide substitution as previously described, was found with 11 of the 22 samples having the A274 allele (Table 2). No other nucleotide substitutions were present. This data was combined with that from Hafalla et al [12] to consider the geographic distribution of Pfs28 alleles. In Asia/Pacific isolates, 42 of 48 carried the G274 allele while only 1 of 14 of Africa/Americas isolates bore this allele (p < 0.001, Fisher's exact test). While recognizing the size limitations of this study, it is still striking that there is such a significant difference in the geographic distribution of these Pfs28 alleles (Table 2).

Discussion

For the first time, this study addresses the issue of antigenic diversity in PfWARP. This antigen appears to have restricted diversity with infrequent point mutations as defined. Additionally, by documenting the genotype of Pfs28 in field isolates from a larger cohort with wider geographic distribution than in previous studies, we confirm that there are only two alleles of this protein. Restricted antigenic diversity has been described in other sexual stage antigens and is explicable due to the absence of human immune selection pressure [1416]. By contrast, asexual stage candidate antigens such as MSP2 are highly polymorphic due to P. falciparum's immune evasion mechanisms [17].

Pfs28, and its orthologues from other species, Pvs28 (Plasmodium vivax) and Pbs21 (P. berghei) clearly induce antibodies that block parasitic infection in mosquitoes and are thus candidate antigens for inducing transmission blocking immunity in humans either alone [18] or in combination with other mosquito-stage antigens. So far there have been two published vaccine trials in humans with Pfs25 [19] and with its P. vivax orthologue, Pvs25 [20], with other trials currently underway.

Conclusion

The demonstration of limited sequence variation in the newly described P. falciparum ookinete surface antigen PfWARP and the confirmed highly conserved nature of Pfs28 in clinical samples from a wide geographical distribution, increase the confidence that these proteins may also be suited for mosquito-stage vaccine development.

Declarations

Acknowledgements

We thank the staff of the Victorian Infectious Diseases Reference Laboratory for their support. Thanks to Allan Saul for reviewing the manuscript.

Financial support: Jack Richards and Damon Eisen receive support from the Clinical Centre for Research Excellence in Infectious Diseases, Victorian Infectious Diseases Service, Royal Melbourne Hospital.

Authors’ Affiliations

(1)
Victorian Infectious Diseases Service, Royal Melbourne Hospital
(2)
Malaria Vaccine Development Branch, NIAID, National Institutes of Health

References

  1. Moorthy VS, Good KF, Hill AVS: Malaria vaccine developments. Lancet. 2004, 363: 150-156. 10.1016/S0140-6736(03)15267-1.View ArticlePubMedGoogle Scholar
  2. Carter R: Spatial simulation of malaria transmission and its control by malaria transmission blocking vaccination. Int J Parasitol. 2002, 32: 1617-1624. 10.1016/S0020-7519(02)00190-X.View ArticlePubMedGoogle Scholar
  3. Williamson KC: Pfs230: from malaria transmission-blocking vaccine candidate toward function. Parasite Immunol. 2003, 25: 351-359. 10.1046/j.1365-3024.2003.00643.x.View ArticlePubMedGoogle Scholar
  4. Carter R: Transmission blocking malaria vaccines. Vaccine. 2001, 19: 2309-2314. 10.1016/S0264-410X(00)00521-1.View ArticlePubMedGoogle Scholar
  5. Yuda M, Yano K, Tsuboi T, Torii M, Chinzei Y: von Willebrand Factor A Domain-related Protein, a novel microneme protein of the malaria ookinete highly conserved throughout Plasmodium parasites. Mol Biochem Parasitol. 2001, 116: 65-72. 10.1016/S0166-6851(01)00304-8.View ArticlePubMedGoogle Scholar
  6. Li F, Templeton TJ, Popov V, Comer JE, Tsuboi T, Torii M, Vinetz JM: Plasmodium ookinete-secreted proteins secreted through a common micronemal pathway are targets of blocking malaria transmission. J Biol Chem. 2004, 279: 26635-26644. 10.1074/jbc.M401385200.View ArticlePubMedGoogle Scholar
  7. Abraham EG, Islam S, Srinivasan P, Ghosh AK, Valenzuela JG, Ribeiro JM, Kafatos FC, Dimopoulos G, Jacobs-Lorena M: Analysis of the Plasmodium and Anopheles transcriptional repertoire during ookinete development and midgut invasion. J Biol Chem. 2004, 279: 5573-5580. 10.1074/jbc.M307582200.View ArticlePubMedGoogle Scholar
  8. Whittaker CA, Hynes RO: Distribution and evolution of von Willebrand/integrin A domains: widely dispersed domains with roles in cell adhesion and elsewhere. Mol Biol Cell. 2002, 13: 3369-3387. 10.1091/mbc.E02-05-0259.PubMed CentralView ArticlePubMedGoogle Scholar
  9. Gozar MM, Price VL, Kaslow DC: Saccharomyces cerevisiae-secreted fusion proteins Pfs25 and Pfs28 elicit potent Plasmodium falciparum transmission-blocking antibodies in mice. Infect Immun. 1998, 66: 59-64.PubMed CentralPubMedGoogle Scholar
  10. Kaslow DC, Quakyi IA, Syin C, Raum MG, Keister DB, Coligan JE, McCutchan TF, Miller LH: A vaccine candidate from the sexual stage of human malaria that contains EGF-like domains. Nature. 1988, 333: 74-76. 10.1038/333074a0.View ArticlePubMedGoogle Scholar
  11. Duffy PE, Kaslow DC: A novel malaria protein, Pfs28, and Pfs25 are genetically linked and synergistic as falciparum malaria transmission-blocking vaccines. Infect Immun. 1997, 65: 1109-1113.PubMed CentralPubMedGoogle Scholar
  12. Hafalla JC, Santiago ML, Pasay MC, Ramirez BL, Gozar MM, Saul A, Kaslow DC: Minimal variation in the Pfs28 ookinete antigen from Philippine field isolates of Plasmodium falciparum. Mol Biochem Parasitol. 1997, 87: 97-99. 10.1016/S0166-6851(97)00042-X.View ArticlePubMedGoogle Scholar
  13. Eisen D, Billman-Jacobe H, Marshall VF, Fryauff D, Coppel RL: Temporal variation of the merozoite surface protein-2 gene of Plasmodium falciparum. Infect Immun. 1998, 66: 239-246.PubMed CentralPubMedGoogle Scholar
  14. Kaslow DC, Quakyi IA, Keister DB: Minimal variation in a vaccine candidate from the sexual stage of Plasmodium falciparum. Mol Biochem Parasitol. 1989, 32: 101-104. 10.1016/0166-6851(89)90134-5.View ArticlePubMedGoogle Scholar
  15. Tsuboi T, Kaslow DC, Gozar MM, Tachibana M, Cao YM, Torii M: Sequence polymorphism in two novel Plasmodium vivax ookinete surface proteins, Pvs25 and Pvs28, that are malaria transmission-blocking vaccine candidates. Mol Med. 1998, 4: 772-782.PubMed CentralPubMedGoogle Scholar
  16. Ya-Ping S, Alpers MP, Povoa MM, Lal AA: Single amino acid variation in the ookinete vaccine antigen from field isolates of Plasmodium falciparum. Mol Biochem Parasitol. 1992, 50: 179-180. 10.1016/0166-6851(92)90254-H.View ArticleGoogle Scholar
  17. Eisen DP, Saul A, Fryauff DJ, Reeder JC, Coppel RL: Alterations in Plasmodium falciparum genotypes during sequential infections suggest the presence of strain specific immunity. Am J Trop Med Hyg. 2002, 67: 8-16.PubMedGoogle Scholar
  18. Hisaeda H, Collins WE, Saul A, Stowers AW: Antibodies to Plasmodium vivax transmission-blocking vaccine candidate antigens Pvs25 and Pvs28 do not show synergism. Vaccine. 2001, 20: 763-770. 10.1016/S0264-410X(01)00402-9.View ArticlePubMedGoogle Scholar
  19. Kaslow DC: Transmission-blocking vaccines. Chem Immunol. 2002, 80: 287-307.View ArticlePubMedGoogle Scholar
  20. Malkin EM, Durbin AP, Diemert DJ, Sattabongkot J, Wu Y, Miura K, Long CA, Lambert L, Miles AP, Wang J, Stowers A, Miller LH, Saul A: Phase 1 vaccine trial of Pvs25H: a transmission blocking vaccine for Plasmodium vivax malaria. Vaccine. 2005, 23: 3131-3138. 10.1016/j.vaccine.2004.12.019.View ArticlePubMedGoogle Scholar

Copyright

© Richards et al; licensee BioMed Central Ltd. 2006

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Advertisement