Island-wide diversity in single nucleotide polymorphisms of the Plasmodium vivax dihydrofolate reductase and dihydropteroate synthetase genes in Sri Lanka
DOI: 10.1186/1475-2875-6-28
© Schousboe et al; licensee BioMed Central Ltd. 2007
Received: 28 November 2006
Accepted: 09 March 2007
Published: 09 March 2007
Abstract
Background
Single nucleotide polymorphisms (SNPs) in the Plasmodium vivax dihydrofolate reductase (Pfdhfr) and dihydropteroate synthetase (Pvdhps) genes cause parasite resistance to the antifolate drug combination, sulphadoxine/pyrimethamine (SP). Monitoring these SNPs provide insights into the level of drug pressure caused by SP use and presumably other antifolate drugs. In Sri Lanka, chloroquine (CQ) with primaquine (PQ) and SP with PQ is used as first and second line treatment, respectively, against uncomplicated Plasmodium falciparum and/or P. vivax infections. CQ/PQ is still efficacious against P. vivax infections, thus SP is rarely used and it is assumed that the prevalence of SNPs related to P. vivax SP resistance is low. However, this has not been assessed in Sri Lanka as in most other parts of Asia. This study describes the prevalence and distribution of SNPs related to P. vivax SP resistance across Sri Lanka.
Subjects and methods
P. vivax- positive samples were collected from subjects presenting at government health facilities across nine of the major malaria endemic districts on the island. The samples were analysed for SNPs/haplotypes at codon 57, 58, 61 and 117 of the Pvdhfr gene and 383, 553 and 585 of the Pvdhps gene by applying PCR followed by a hybridization step using sequence specific oligonucleotide probes (SSOPs) in an ELISA format.
Results
In the study period, the government of Sri Lanka recorded 2,149 P. vivax cases from the nine districts out of which, 454 (21.1%) blood samples were obtained. Pvdhfr haplotypes could be constructed for 373 of these. The FSTS wild-haplotype was represented in 257 samples (68.9%), the double mutant LRTS haplotype was the most frequently observed mutant (24.4%) while the triple mutation (LRTN) was only identified once. Except for two samples of the single mutated Pvdhps GAV haplotype, the remaining samples were wildtype. Geographical differences were apparent, notably a significantly higher frequency of mutant Pvdhfr haplotypes was observed in the Northern districts.
Conclusion
Since SP is rarely used in Sri Lanka, the high frequency and diversity of Pvdhfr mutations was unexpected indicating the emergence of drug resistant parasites despite a low level of SP drug pressure.
Background
Plasmodium vivax is the most geographically widespread of the four Plasmodium species infective to humans found throughout South and Central America, Asia, the Middle East, and parts of Africa and infects an estimated 70–80 million people annually [1]. Chloroquine (CQ)-resistant Plasmodium falciparum, and to a lesser extent CQ resistant P. vivax, is almost as endemic as malaria itself and alternatives such as the drug combination sulphadoxine/pyrimethamine (SP) have replaced CQ. Resistance to SP has recently emerged for P. falciparum, while for P. vivax it has been observed sporadically [2]. The molecular mechanisms involved in the development of SP resistance of the two species are most likely similar [3, 4]. In P. falciparum, single nucleotide polymorphisms (SNPs) in codon (c) 51, c59 and c108 of the Pfdhfr gene and in c437 and c540 of Pfdhps gene provide pyrimethamine and sulphadoxine resistance, respectively and these SNPs combined result in high risk of SP treatment failure in vivo [5]. For P. vivax, the picture is more complex because pyrimethamine resistance possibly involve several SNPs [6]. However, some evidence support that resistance is mainly associated with mutations at c58 (S58R, occurring as two SNPs, either AGA (R1) or AGG (R2)) and c117 (S117N or S117T) with additional mutations at c57 (F57L-existing as three SNPs, CTC (L1), TTG (L2) and TTA (L3)) and c61 (T61M) in the Pvdhfr gene [3, 4, 6–8]. The quadruple mutant haplotype (57L+58R+61M+117T) has been shown to correlate with SP treatment failure in vivo [8] and increases P. vivax resistance to pyrimethamine by more than 500 times [4, 6].
Presumably, P. vivax sulphadoxine resistance is caused by SNPs in the Pvdhps gene. Based on homology models of both P. falciparum and P. vivax DHPS enzymes, Korsinczky et al. predicted that the P. vivax wildtype at c585 (V585) possibly cause some level of innate sulphadoxine resistance, while SNPs at c383 (A383G) and c553 (A553G) in Pvdhps most likely increase resistance levels [9]. Imwong et al. showed that only in regions with high SP usage, SNPs in both Pvdhfr and Pfdhps were observed and, furthermore, parasites harbouring multiple mutations in Pvdhfr and Pvdhps were cleared more slowly from the blood of patients following SP treatment [10]. Therefore, P. vivax SP resistance is most likely measurable by examining the frequency of SNPs in both the Pvdhfr and Pvdhps genes.
In Sri Lanka, CQ plus primaquine (PQ) and SP plus PQ are used as 1st- and 2nd-line treatment, respectively, against uncomplicated malaria infections, although CQ resistant P. falciparum infections have been reported since 1984 and P. falciparum SP resistance has been observed recently [11]. P. vivax resistance to either CQ or SP has not been recorded on the island. This study investigated the frequency of SNPs/haplotypes in the Pvdhfr (at c57, 58, 61 and 117) and Pvdhps (at c383, 553 and 585) genes in samples collected from nine districts with endemic P. vivax malaria in Sri Lanka over a 1 1/2-year period. The detection of SNPs/haplotypes in Pvdhfr and Pvdhps was performed by applying a new simple enzyme-linked immunosorbent assay (ELISA) using sequence specific oligonucleotide probes (SSOPs) similar to the method detecting SNPs/haplotypes in P. falciparum dhfr, dhps and crt [12].
Materials and methods
The samples originated from individuals seeking treatment for malaria at government health facilities located in nine different malarious district across Sri Lanka. In Sri Lanka the great majority of individuals with perceived malaria seek treatment at government facilities [13]. Samples were collected by routine staff at the facilities trained by the Anti-Malaria Campaign (AMC) of Sri Lanka from September 2004 to March 2006, thereby including the traditionally malaria peak transmission seasons in January and one lower peak season around July. Finger prick blood from patients with single P. vivax or mixed P. vivax/P. falciparum infections, diagnosed by microscopy were spotted on filter paper and sealed in individual zip-lock bags. DNA extraction was carried out by the chelex-100 method as described in [12].
The sequence specific oligonucleotide probes (SSOPs) targeting SNPs/haplotypes in c57, 58, 61 and 117 of the Pvdhfr gene and c383, 553 and 585 in the Pvdhps gene and artificial positive controls.
SSOP | SSOP sequence † | Washing temperature § | Incubation time ¶ |
|---|---|---|---|
Pvdhfr | (C°) | Min. | |
57/58/61 FST | AC TTC AGC TCG GTG ACG A | 60 | 12 |
57/58/61 FR1T | AC TTC AGA TCG GTG ACG A | 60 | 10 |
57/58/61 FR2T | AC TTC AGG TCG GTG ACG A | 60 | 10 |
57/58/61 L1R2M | ACCTC AGG TCG GTG ATG A | 62 | 10 |
57/58/61 L2ST | AC TTG AGC TCG GTG ACG A | 60 | 10 |
57/58/61 L2R1T | AC TTG AGA TCG GTGACG A | 64 | 10 |
57/58/61 L3R2T | AC TTA AGG TCG GTG ACG A | 62 | 10 |
117 S | G AGA AGC AGC TGG GAG AG | 60 | 12 |
117 N | G AGA AGC AAC TGG GAG AG | 60 | 10 |
117 T | G AGA AGC ACC TGG GAG AG | 60 | 10 |
Pvdhps | |||
383A | A TCG TCC GCC CCT TAT GT | 64 | 10 |
c383 G | A TCG TCC GGC CCT TAT GT | 64 | 10 |
c553A | TC GGC CTG GGG TTTGCC A | 64 | 10 |
c553G | TC GGC CTG GGG TTTGGC A | 64 | 10 |
c585V | C TTT ATT GTC CAC TGC AT | 64 | 10 |
Positive controls* | |||
Pvdhfr | Sequence | ||
PcL3R2T | TCCGTCGATATGAAGTACTTAAGG TCGGTGACG ACCTACGTGGATGAGTC | ||
Pvdhps | |||
Pc383G | GATTGACATCGGGGGGGAATCGTCCGGC CCTTATGTGGTCCCCAATCCGA | ||
Pc553G | CTTTGATGTCGGCCTGGGGTTTGGC AAAAAGCACGACCAGTCTATTAAGC |
The outer and nested Pvdhfr PCR protocols used are described in [14], with the exception that the reverse nested primer, KH-3R was biotinylated at the 5'-end by the supplier (MWG Biotech, Riskov, Denmark). The outer Pvdhps PCR primers used (PvDHPS-D and PvDHPS-B) and protocols are described by [9]. The nested Pvdhps primers were designed; NL-1 (5'-GCGAGCGTGATTGACATC-3') and NR-1-(5'-GCTCATCAGTCTGCACTCC-3') where the reverse primer, NR-1, was biotinylated at the 5'-end. The outer and nested Pvdhps PCR were performed as follows: denaturation at 94° C for 2 min followed by 40 cycles of 94° C for 30 sec, 50° C for 30 sec and 65°C for 1 1/2 min and subsequently a 5 min extension step at 65°C.
A SSOP-ELISA, similar to the method for SNP/haplotype analysis of P. falciparum dhfr/dhps was developed [12], however using pre-coated streptavidin plates (Nunc, Roskilde, Denmark). The 3'-end digoxigenin-conjugated SSOPs designed to target the most common Pvdhfr and Pvdhps SNP/haplotypes including the time and temperatures in the two rounds of high stringency washing with tetra-methyl-ammonium chloride (TMAC) is given in table 1. Scoring of ELISA data were performed as described elsewhere [12]. To verify the results, Restriction Fragment Length Polymorphism (RFLP) was performed on a subset of the samples using enzymes and methods described by [15]. Polymorphisms in c383 of the Pvdhps gene were identified by digestion with the restriction enzyme HaeIII (New England Biolabs, Medinova, Glostrup, Denmark).
Sequencing was performed on a subset of samples to clarify some of the Pvdhfr and Pvdhps haplotypes; PCR products with A-overhang were cloned into the TOPO TA vector according to manufacturing procedures (Invitrogen), and plasmids were prepared using MiniPrep spin columns (Omega Biotech). Sequencing was done on an ABI Prism 377 (Perkin-Elmer) using the Big Dye terminator reaction mix (Perkin-Elmer).
Ethical clearance for this project was granted by the Committee on Research and Ethical Review at the Faculty of Medicine, Peradeniya, Kandy and verbal consent was obtained from participants, parents and/or guardians.
Results
In the study period, AMC recorded a total of 2717 P. vivax cases in the country, out of which, 2,149 cases came from the nine districts included in this study (79.1%). 454 (21.1%) blood samples from these districts, representing a large range of catchments efficiencies from 7.7% (Monaragala) to 67.5% (Polonnaruwa) were examined. The samples were analysed for SNPs/haplotypes at position c57, 58, 61 and 117 of the Pvdhfr gene and c383, 553 and 585 (only detection of the wildtype V585) of the Pvdhps gene using an array of SSOPs. Samples either repeatedly PCR negative or negative in one or more of the Pvdhfr or Pvdhps codons were omitted from the analysis.
The distribution of Plasmodium vivax dhfr haplotypes at c57 (F->L), 58 (S->R), 61 (T) and 117 (S->N) in samples collected from P. vivax positive patients in 9 districts of Sri Lanka. The number in brackets is the actual number of P. vivax positive cases reported by Anti Malaria Campaign of Sri Lanka in the study period September 2004–March 2006. In red: the wild type to mutant type change in amino acids
A subset of samples analysed by sequencing (mainly to confirm the c57L3) and by digestion of c58 and 117 in the Pvdhfr gene by RFLP confirmed the data obtained be the Pvdhfr SSOP-ELISA.
The Pvdhps haplotypes could be constructed for 368 of the 373 Pvdhfr positive samples (98.7 %). Wildtype haplotypes at c383, 553 and 585 (AAV) was seen in 366 of these samples, while two samples from Trincomalee were of the single mutated GAV haplotype. These were confirmed by sequencing. Both samples expressed the double mutated FRTN haplotype in Pvdhfr.
Discussion
The present descriptive study analysed sulphadoxine/pyrimethamine (SP) resistance-related SNPs in the P. vivax dhfr and Pvdhps genes in samples originating from nine districts in Sri Lanka, a country were both CQ and SP (in combination with primaquine) is still regarded as efficient treatment against uncomplicated P. falciparum and/or P. vivax infections. The analysis identified six different haplotypes of Pvdhfr while for Pvdhps, only wildtypes were identified except for two cases.
The double mutant haplotype LRTS (F57L, S58R, T61,117S) was the most frequent mutant haplotype and not as expected as a combination of S117N and S58R (FRTN) as observed previously [6, 8, 16] and in a recent study from India [17]. The P. vivax triple mutant haplotype LRTN, previously found in Thailand and shown to be associated with reduced ability of patients to decrease parasites ratios [15] was only found once and the quadruple LRMT mutant haplotype causing a high risk of SP treatment failures [8] was not detected, thus indicating that SP (with primaquine) is still efficient against P. vivax infections in Sri Lanka. Nevertheless, it is surprising that almost one third of the tested P. vivax infections were mutated in the Pvdhfr gene, despite that, officially, SP is only used as second-line drug against CQ treatment failures of P. falciparum. A recent study investigating the availability of SP in privately-owned drug vendor shops in Sri Lanka found that SP was virtually absent from the shops [18], thus the specific drug pressure is unlikely to be caused by unauthorized use. More plausible, the mutations are not only an indication of emerging pyrimethamine resistance, but instead reflect the overall antifolate pressure in Sri Lanka. Presently, antifolates such as dapsone, co-trimoxazole and trimethoprim are for instance used against urinary tract infections and chronic bronchitis on the island. Alternatively, similar to development of P. falciparum resistance to pyrimethamine in vivo, P. vivax populations are occasionally exposed to sub-therapeutic levels of pyrimethamine when re-infecting recently SP-treated patients thereby providing optimal conditions for the emergence of SP tolerant P. vivax parasites [19]. Thus, even low drug pressure may facilitate the emergence of drug tolerant/resistant parasites and this may particularly be the case for P. vivax that to a larger extend than P. falciparum possibly can persist in the host unnoticed.
The frequency of Pvdhfr mutant haplotypes was significantly higher in the most Northern regions (Mannar, Vavuniya and Trincomalee) than the rest of the districts examined. This might be indirectly caused by the civil unrest resulting in a shortage of trained medical personnel, non-accurate malaria diagnosis and an underestimation of malaria infections mainly in the Northern part of Sri Lanka [20]. Furthermore, the FRTN haplotype was only observed in the Northern districts and it may be speculated that human migration between Southern India and the Northern part of Sri Lanka has introduced this particular haplotype from the Southern district of Chennai where it is highly prevalent [17]. The limited number of samples received from some districts, e.g. Monaragala, Ampara, Batticaloa, Mannar and Vavuniya, limits interpretation.
The high frequency of mutant haplotypes related to pyrimethamine resistance is worrying because it indicates that drug tolerant/resistant P. vivax parasites have evolved despite a low level of SP drug pressure, possibly attributed to the use of other antifolate drugs. It is not known whether these mutant P. vivax haplotypes do exhibit SP resistance in vivo.
Declarations
Acknowledgements
The Regional Medical Officers and the technical personnel are thanked for supplying the filter paper blood samples and laboratory technician Ulla Abildrup are thanked for excellent technical assistance. Carol Sibley are thanked for kindly providing the P. vivax dhfr samples.
Authors’ Affiliations
References
- Mendis K, Sina BJ, Marchesini P, Carter R: The neglected burden of Plasmodium vivax malaria. Am J Trop Med Hyg. 2001, 64: 97-106.PubMedGoogle Scholar
- Pukrittayakamee S, Imwong M, Looareesuwan S, White NJ: Therapeutic responses to antimalarial and antibacterial drugs in vivax malaria. Acta Trop. 2004, 89: 351-356. 10.1016/j.actatropica.2003.10.012.View ArticlePubMedGoogle Scholar
- Eldin P, Basco LK, Tahar R, Ouatas T, Mazabraud A: Analysis of the Plasmodium vivax dihydrofolate reductase-thymidylate synthase gene sequence. Gene. 1998, 211: 177-185. 10.1016/S0378-1119(98)00118-8.View ArticleGoogle Scholar
- Hastings MD, Porter KM, Maguire JD, Susanti I, Kania W, Bangs MJ, Hopkins SC, Baird JK: Dihydrofolate Reductase Mutations in Plasmodium vivax from Indonesia and Therapeutic Response to Sulfadoxine Plus Pyrimethamine. J Infect Dis. 2004, 189: 744-750. 10.1086/381397.View ArticlePubMedGoogle Scholar
- Kublin JG, Dzinjalamala FK, Kamwendo DD, Malkin EM, Cortese JF, Martino LM, Mukadam RA, Rogerson SJ, Lescano AG, Molyneux ME, Winstanley PA, Chimpeni P, Taylor TE, Plowe CV: Molecular markers for failure of sulfadoxine-pyrimethamine and chlorproguanil-dapsone treatment of Plasmodium falciparum malaria. J Infect Dis. 2002, 185: 380-388. 10.1086/338566.View ArticlePubMedGoogle Scholar
- Hastings MD, Maguire JD, Bangs MJ, Zimmerman PA, Reeder JC, Baird JK, Sibley CH: Novel Plasmodium vivax dhfr alleles from the Indonesian Archipelago and Papua New Guinea: association with pyrimethamine resistance determined by a Saccharomyces cerevisiae expression system. Antimicrob Agents Chemother. 2005, 49: 733-740. 10.1128/AAC.49.2.733-740.2005.PubMed CentralView ArticlePubMedGoogle Scholar
- Imwong M, Pukrittayakamee S, Renia L, Letourneur F, Charlieu JP, Leartsakulpanich U, Looareesuwan S, White NJ, Snounou G: Novel point mutations in the dihydrofolate reductase gene of Plasmodium vivax: evidence for sequential selection by drug pressure. Antimicrob Agents Chemother. 2003, 47: 1514-1521. 10.1128/AAC.47.5.1514-1521.2003.PubMed CentralView ArticlePubMedGoogle Scholar
- Tjitra E, Baker J, Suprianto S, Cheng Q, Anstey NM: Therapeutic efficacies of artesunate-sulfadoxine-pyrimethamine and chloroquine-sulfadoxine-pyrimethamine in vivax malaria pilot studies: relationship to Plasmodium vivax dhfr mutations. Antimicrob Agents Chemother. 2002, 46: 3947-3953. 10.1128/AAC.46.12.3947-3953.2002.PubMed CentralView ArticlePubMedGoogle Scholar
- Korsinczky M, Fischer K, Chen N, Baker J, Rieckmann K, Cheng Q: Sulfadoxine resistance in Plasmodium vivax is associated with a specific amino acid in dihydropteroate synthase at the putative sulfadoxine-binding site. Antimicrob Agents Chemother. 2004, 48: 2214-2222. 10.1128/AAC.48.6.2214-2222.2004.PubMed CentralView ArticlePubMedGoogle Scholar
- Imwong M, Pukrittayakamee S, Cheng Q, Moore C, Looareesuwan S, Snounou G, White NJ, Day NP: Limited polymorphism in the dihydropteroate synthetase gene (dhps) of Plasmodium vivax isolates from Thailand. Antimicrob Agents Chemother. 2005, 49: 4393-4395. 10.1128/AAC.49.10.4393-4395.2005.PubMed CentralView ArticlePubMedGoogle Scholar
- Hapuarachchi HC, Dayanath MY, Bandara KB, Abeysundara S, Abeyewickreme W, de Silva NR, Hunt SY, Sibley CH: Point mutations in the dihydrofolate reductase and dihydropteroate synthase genes of Plasmodium falciparum and resistance to sulfadoxine-pyrimethamine in Sri Lanka. Am J Trop Med Hyg. 2006, 74: 198-204.PubMedGoogle Scholar
- Alifrangis M, Enosse S, Pearce R, Drakeley C, Roper C, Khalil IF, Nkya WM, Ronn AM, Theander TG, Bygbjerg IC: A simple high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum cloroquine resistance transporter genes using ploymerase chain reaction and enzyme linked immunosorbent assay-based technology. Am J Trop Med Hyg. 2005, 72: 155-162.PubMedGoogle Scholar
- Konradsen F, Van der HW, Amerasinghe PH, Amerasinghe FP, Fonseka KT: Household responses to malaria and their costs: a study from rural Sri Lanka. Trans R Soc Trop Med Hyg. 1997, 91: 127-130. 10.1016/S0035-9203(97)90194-2.View ArticlePubMedGoogle Scholar
- de Pecoulas PE, Tahar R, Yi P, Thai KH, Basco LK: Genetic variation of the dihydrofolate reductase gene in Plasmodium vivax in Snoul, northeastern Cambodia. Acta Trop. 2004, 92: 1-6. 10.1016/j.actatropica.2004.03.011.View ArticlePubMedGoogle Scholar
- Imwong M, Pukrittakayamee S, Looareesuwan S, Pasvol G, Poirreiz J, White NJ, Snounou G: Association of genetic mutations in Plasmodium vivax dhfr with resistance to sulfadoxine-pyrimethamine: geographical and clinical correlates. Antimicrob Agents Chemother. 2001, 45: 3122-3127. 10.1128/AAC.45.11.3122-3127.2001.PubMed CentralView ArticlePubMedGoogle Scholar
- de Pecoulas PE, Tahar R, Ouatas T, Mazabraud A, Basco LK: Sequence variations in the Plasmodium vivax dihydrofolate reductase-thymidylate synthase gene and their relationship with pyrimethamine resistance. Mol Biochem Parasitol. 1998, 92: 265-273. 10.1016/S0166-6851(97)00247-8.View ArticlePubMedGoogle Scholar
- Kaur S, Prajapati SK, Kalyanaraman K, Mohmmed A, Joshi H, Chauhan VS: Plasmodium vivax dihydrofolate reductase point mutations from the Indian subcontinent. Acta Trop. 2006, 97: 174-180. 10.1016/j.actatropica.2005.10.003.View ArticlePubMedGoogle Scholar
- Rajakaruna RS, Weerasinghe M, Alifrangis M, Amerasinghe PH, Konradsen F: The role of private drug vendors as malaria treatment providers in selected malaria endemic areas of Sri Lanka. J Vector Borne Dis. 2006, 43: 58-65.PubMedGoogle Scholar
- Hastings IM, Watkins WM: Tolerance is the key to understanding antimalarial drug resistance. Trends Parasitol. 2006, 22: 71-77. 10.1016/j.pt.2005.12.011.View ArticlePubMedGoogle Scholar
- Briet OJ, Gunawardena DM, Van der HW, Amerasinghe FP: Sri Lanka malaria maps. Malar J. 2003, 2: 22-10.1186/1475-2875-2-22.PubMed CentralView ArticlePubMedGoogle Scholar
Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
View archived comments (1)