Open Access

Maternal peripheral blood level of IL-10 as a marker for inflammatory placental malaria

  • Edward R Kabyemela1, 2,
  • Atis Muehlenbachs1, 3,
  • Michal Fried1, 3,
  • Jonathan D Kurtis4,
  • Theonest K Mutabingwa1, 5 and
  • Patrick E Duffy1, 3Email author
Contributed equally
Malaria Journal20087:26

DOI: 10.1186/1475-2875-7-26

Received: 04 October 2007

Accepted: 29 January 2008

Published: 29 January 2008

Placental malaria (PM) is an important cause of maternal and foetal mortality in tropical areas, and severe sequelae and mortality are related to inflammation in the placenta. Diagnosis is difficult because PM is often asymptomatic, peripheral blood smear examination detects parasitemia as few as half of PM cases, and no peripheral markers have been validated for placental inflammation.

In a cohort of Tanzanian parturients, PM was determined by placental blood smears and placental inflammation was assessed by histology and TNF mRNA levels. Maternal peripheral blood levels of several immune mediators previously implicated in PM pathogenesis, as well as ferritin and leptin were measured. The relationship between the levels of these soluble factors to PM and placental inflammation was examined.

Peripheral levels of TNF, TNF-RI, TNF-RII, IL-1, IL-10, and ferritin were elevated during PM, whereas levels of IFN-γ, IL-4, IL-5 and IL-6 were unchanged and levels of leptin were decreased. In receiver operating characteristic curve analysis, IL-10 had the greatest area under the curve, and would provide a sensitivity of 60% with a false positive rate of 10%. At a cut off level of 15 pg/mL, IL-10 would detect PM with a sensitivity of 79.5% and a specificity of 84.3%. IL-10 levels correlated with placental inflammatory cells and placental TNF mRNA levels in first time mothers.

These data suggest that IL-10 may have utility as a biomarker for inflammatory PM in research studies, but that additional biomarkers may be required to improve clinical diagnosis and management of malaria during pregnancy.

Placental malaria (PM) due to Plasmodium falciparum is a major cause of mortality for mothers and their offspring, and is most frequent and severe during first pregnancies [1]. PM is caused by parasite-infected erythrocytes that bind to chondroitin sulfate A (CSA) and sequester in the placenta [2]. In histologic studies, PM can appear as an acute condition with little to no inflammation, or as a chronic disorder with sometimes heavy inflammation and deposition of parasite haemozoin (also called pigment) [3]. Chronic inflammatory PM has been most closely related to poor maternal and foetal outcomes in earlier studies [4]. In areas of stable malaria transmission, first time mothers often develop chronic PM, with inflammatory infiltrates and elevated Type 1 cytokines in the placenta [4, 5].

Antenatal diagnosis of PM by Giemsa-stained blood smears fails to identify a substantial proportion of PM cases [6], possibly as many as half [1] and no tools exist that can predict poor pregnancy outcomes. PCR-based detection of P. falciparum DNA in peripheral blood is frequently positive when peripheral blood smear is negative. However, PCR can detect dead parasites, free parasite DNA, or DNA in phagocytic cells, and PCR-detection is not associated with pregnancy outcomes [6]. Antigen capture tests show promise, but they yield information only on parasitaemia and not inflammation [7]. A recent study from Kenya reported an association between plasma urokinase receptor levels measured at delivery and low birth weight in maternal malaria [8], suggesting that host biomarkers may be useful for discriminating women likely to experience poor outcomes from other women. Peripheral biomarkers of placental inflammation may be of particular value, since this condition is related to poor outcomes. In the present study peripheral blood levels of several immune mediators and other proteins in a cohort of Tanzanian women was examined at the time of delivery, and their associations with PM and placental inflammation was determined.

Clinical procedures

Placental samples, peripheral blood and clinical information were provided by Tanzanian women aged 18 to 45 years delivering at the Muheza Designated District Hospital, Muheza, Tanga region, in an area of intense malaria transmission. These women were participating in a birth cohort study known locally as the Mother-Offspring Malaria Studies (MOMS) Project. Women signed an informed consent form before joining the study, and women with known HIV or HIV-related sequelae in their offspring were excluded. Routine microbiological testing for other infectious diseases was not performed at the study site. Clinical information was collected by project nurses and assistant medical officers on standardized forms. Study procedures involving human subjects were approved by the International Clinical Studies Review Committee of the Division of Microbiology and Infectious Diseases at the US National Institutes of Health, and ethical clearance was obtained from the Institutional Review Boards of Seattle Biomedical Research Institute and the National Institute for Medical Research in Tanzania.

Peripheral blood was collected in citrate phosphate dextrose around the time of delivery, and plasma was separated and frozen at -80°C. The placenta was collected at delivery, and a full thickness biopsy from the middle third of the placental disc was taken. Tissue was fresh frozen in liquid nitrogen and stored at -80°C. Placental blood samples were obtained by manual compression of the placental tissue in a grinder. Placental parasitaemia was defined as the identification of any parasites in a placental blood slide by microscopy. Thick and thin smears were prepared; thin smears were fixed with methanol. Blood slides were stained for 10 minutes in 10% Giemsa, washed in tap water, air-dried, then examined using light microscopy at 1000 × magnification. Ten thousand red cells were examined in the thin smear before concluding that a placental blood slide was negative.

Laboratory procedures

Plasma levels of cytokines, cytokine receptors, ferritin and leptin were analyzed using a multiplexed, bead-based platform (BioPlex®, BioRad, Irvine, CA) and custom-made assay kits as previously described [9]. Detection limits for these assays were as follows: TNF 0.10 pg/ml, TNF receptor (R) I 1.58 pg/ml, TNF-RII 0.21 pg/ml, IFN-γ 0.04 pg/ml, IL-1 0.01 pg/ml, IL-4 0.30 pg/ml, IL-5 0.02 pg/ml, IL-6 0.45 pg/ml, IL-10 0.02 pg/ml, ferritin 0.07 ng/ml, and leptin 1.28 pg/ml. Levels of soluble factors were adjusted to account for dilution in anticoagulant at the time of sample collection. For each plasma sample, all analytes were assayed in a single day, thus eliminating freeze/thaw cycles.

For histologic analysis, PM-positive tissue was selected and 5 mm cryosections of placental tissue were fixed in methanol and stained with Giemsa. Sections were assessed by examining greater than ninety 600 × fields per section. Immune infiltrates within the intervillous spaces were qualitatively scored as (-) for none or very few inflammatory cells present, (+) for inflammatory cells present. Histological analysis was performed by a single observer (A.M.).

Quantitative PCR was performed as described elsewhere [10]. Briefly total RNA was extracted from frozen cryosections using RNeasy minikits (Qiagen) and cDNA was synthesized using Superscript III enzyme (Invitrogen) and anchored oligodT20 primers. Real-time PCR was performed in duplicate using SYBR green master mix and an ABI Prism 7000 or 7500 (Applied Biosystems). Threshold cycles (CT) were calculated and normalized to CT of KRT7 (a gene expressed by trophoblasts and not by inflammatory cells). Data are presented as fold-difference from control gene, calculated by 2(control CT-gene CT). The oligonucleotide primers used for PCR reactions included: TNF Forward CACGCTCTTCTGCCTGCT; TNF-α Reverse CAGCTTGAGGGTTTGCTACA; KRT7 forward: GGCTGAGATCGACAACATCA; KRT7 reverse: CTTGGCACGAGCATCCTT.

Statistical analysis

Student's t-test was used for the analysis of maternal age and birth weight within primigravid (first pregnancy) and multigravid (second and later pregnancy) groups. Mann-Whitney test was used to examine cytokine levels. Linear regression coefficients were calculated using simple regression analysis. Receiver operating characteristic (ROC) curve and area under the curve (AUC) analyses were performed with IL-10 and other soluble factors levels as continuous variables using JROCFIT and JLABROC4 algorithms that are available online at the URL [11]. Sensitivities and specificities of elevated IL-10 to detect PM were calculated at specific cutoff levels of 10 pg/ml, 15 pg/ml or 35 pg/ml. Other analyses were performed using Statview 5.0.1 (SAS Institute, Cary, North Carolina, United States).

Peripheral plasma samples used for these studies were provided by 660 women delivering singleton live-born babies in Muheza, Tanzania. Clinical data are shown in Table 1. PM+ multigravid women were younger than PM- multigravid women, and birthweight was significantly lower in PM+ deliveries compared to PM- deliveries in both gravidity groups.
Table 1

Characteristics of the study population. *

PM- (n = 166)

PM+ (n = 39)

PM- (n = 415)

PM+ (n = 40)

Maternal age in years (Mean; SD)

20.6 (3.3)

19.7 (1.9)

28.9 (5.9)

25.7 (4.4)

Birth weight in kg (Mean; SD)

3.10 (0.43)

2.83 (0.42)

3.25 (0.386)

3.04 (0.36)

*Data presented are Mean (SD).

Peripheral levels of cytokines, leptin and ferritin vary during PM

Comparison of concentrations of cytokines and other soluble factors in maternal peripheral blood stratified for PM and parity is shown in Table 2. PM significantly increased peripheral levels of TNF, TNF-RII, IL-10 and ferritin in women of both parities. Peripheral levels of TNF-RI and IL-1 significantly increased while levels of leptin significantly decreased in primigravid but not multigravid women during PM. The levels of other soluble factors were similar between PM- and PM+ women.
Table 2

Peripheral levels of cytokines and other soluble factors stratified by parity and PM status.*

PM- (n = 166)

PM+ (n = 39)

PM- (n = 415)

PM+ (n = 40)

22.9 [8.3–46.7]

62.1 [26.3–127.5]

18.7 [8.70–37.9]

57.7 [23.8–84.7]

948 [550–1411]

1374 [851–2290]

812 [481–1249]

1004 [517–1580]

186 [0–494]

673 [260–1425]

190 [0–403]

590 [129–959]

2.28 [0.72–4.36]

5.05 [1.70–11.3]

2.06 [0.73–4.46]

3.06 [0.32–7.36]

0.0 [0.0-0.0]

0.0 [0.0-0.0]

0.0 [0.0-0.0]

0.0 [0.0-0.0]

1.96 [0.39–4.21]

1.76 [0.12–3.32]

2.09 [0.39–4.09]

1.90 [0.89–5.89]

18.4 [9.26–37.6]

29.3 [15.0–42.5]

13.1 [3.75–29.5]

13.2 [8.83–19.2]

5.69 [3.28–11.3]

23.4 [15.1–62.7]

6.12 [2.91–11.6]

22.2 [13.9–40.3]

0.0 [0.0-0.0]

0.0 [0.0–3.67]

0.0 [0.0-0.0]

0.0 [0.0-0.0]

2404 [973–6218]

1029 [658–4115]

2161 [1014–5293]

1490 [452–5052]

14.0 [8.00–32.4]

62.7 [20.8–144.8]

11.6 [6.7–25.9]

40.4 [19.3–82.0]

*Data are presented as median [interquartile ranges]. P-values were calculated by Mann-Whitney test.

Peripheral IL-10 levels are markers of PM and placental inflammation

The soluble factors that were significantly elevated in peripheral blood during PM were analyzed by ROC curve analysis to determine their utility as biomarkers to detect PM (Table 3). IL-10 had the greatest area under the curve (AUC) at 0.83 in first time mothers and 0.82 for all mothers, indicating the highest sensitivity and specificity. The ROC curve for IL-10 in first time mothers is shown in Figure 1. Using an IL-10 cutoff for a false positive rate of 10% would yield a sensitivity of 60%, whereas a cut off for sensitivity of 90% would yield a false positive rate of 50%. Ferritin and TNF-RII had AUC values greater than 0.75 in first time mothers. Derived values, resulting from the combination by summation or addition of IL-10 with either ferritin or TNF-RII provided no improvement in sensitivity and specificity (data not shown).
Table 3

Area under the Receiver Operator Characteristic (ROC) curve to detect PM.*

Soluble factor

All gravidities

*Only cytokines and other soluble factors significantly elevated during PM are shown.
Figure 1

Receiver operator curve for peripheral IL-10 levels in first time mothers to detect PM. Solid line is the best fit curve; dashed lines show the 95% confidence intervals.

The ability of IL-10 elevations above various threshold values to discriminate infected from uninfected women was examined (Table 4). An IL-10 cutoff level of 15 pg/mL yielded values above 75% for both parameters. Peripheral IL-10 levels were specifically elevated in first time mothers who had placental inflammation by histology (Figure 2). Further, peripheral IL-10 levels correlated significantly with placental TNF mRNA (Figure 3).
Table 4

Sensitivity and specificity of discrete IL-10 cut-off levels toclassify cases of PM in first time mothers (n = 205).

IL -10 levels

Sensitivity (%)

Specificity (%)

≥ 10 pg/mL

≥ 15 pg/mL

≥ 35 pg/mL

Figure 2

Peripheral IL-10 levels stratified for maternal parity, PM and the presence of inflammatory cells by placental histology. P-value was calculated using Mann-Whitney test. P0, primigravidae; P1+, multigravidae.
Figure 3

Relationship of peripheral IL-10 levels and placental TNF-α mRNA levels in first time mothers. Gene expression is presented as 2x fold expression over KRT7. Simple regression analysis was used to calculate R and P-values.

Peripheral blood smear analysis has low sensitivity to detect PM. PCR based and antigen capture tests for the diagnosis of PM have increased sensitivity but cannot detect inflammation, which is related to poor pregnancy outcomes. This study suggests that peripheral IL-10 levels may be a useful tool to identify women with inflammatory PM and therefore those likely to have poor pregnancy outcomes. Using a cut-off level of 15 pg/mL, IL-10 levels would detect PM with a sensitivity of 79.5% and specificity of 84.3%. IL-10 may have utility in longitudinal studies, examining the burden of malaria over gestation, when the placenta is not available for microscopic analysis. Future studies should measure IL-10 levels throughout gestation to assess relationships to antenatal parasitemia and to pregnancy outcomes.

IL-10 is a key cytokine both in protection and immunopathology during malaria. High levels of IL-10 observed during malarial episodes may be beneficial by reducing the inflammatory response, but may be detrimental by decreasing antiparasitic cellular immune responses. IL-10 is an anti-inflammatory cytokine that acts in part by blocking monocyte/macrophage production of inflammatory cytokines such as IL-6, TNF, and IL-l [12]. Animal studies have suggested that IL-10 may play a regulatory role during parasitic infection that modulates susceptibility. In particular, IL-10 inhibits the microbicidal activity of IFN-γ-treated macrophages against intracellular parasites such as Toxoplasma gondii [13], Trypanosoma cruzi [14] and Leishmania major [15] and the killing of extracellular Schistosoma mansoni schistosomulas [16]. These effects may result from decreased production of the toxic nitrogen oxide metabolites[17].

The blood stages of P. falciparum are also cleared by phagocytosis and killed by oxidative products of nitric oxide released by macrophages [18]. IL-10 has been previously observed to be elevated during malarial episodes in non-pregnant [19, 20] and pregnant individuals [21]. Both increased and decreased levels of IL-10 have been associated with poor malaria outcomes. Low levels of IL-10 or low IL-10 to TNF ratios were associated with severe malarial anemia in African children [22, 23] while high IL -10 levels were associated with reduced ability to eliminate malaria parasitaemia in Tanzanian children [24].

PM results from the accumulation of parasites that bind to CSA in the intervillous spaces of the placenta [2, 25]. In response to the sequestered mass of parasites, inflammatory cells infiltrate the intervillous spaces This inflammatory infiltrate can be massive, and prominently features monocytes/macrophages. In vitro data suggests these cells are the principal source of IL-10 [21]. In Kenyan children, high levels of peripheral blood IL-10 were positively correlated with binding of infected red blood cells to CD36 [26], but the relevance of this observation to malaria pathogenesis is unknown, and we find that levels of IL-10 also increase when CSA-binding parasites are the major parasite form causing infection. Placental levels of TNF increase during PM [5, 21, 27] and TNF gene expression is specifically related to placental inflammation [10]. Increased placental blood levels of TNF are related to poor outcomes for both the mother and her newborn [5, 27]. In the present study, placental TNF mRNA positively correlated to peripheral blood IL-10 levels in first-time mothers, strengthening the association between peripheral IL-10 levels and placental inflammation.

The present data indicate that peripheral ferritin levels are also elevated during PM. Ferritin is a positive acute phase protein and is known to increase during infection and injury. In non-pregnant individuals, ferritin levels increase during both asymptomatic and symptomatic malaria, and the highest levels have been recorded in individuals with severe disease [28]. Serum ferritin may also increase in the presence of subclinical infection [29]. During the acute phase response, inflammatory cytokines such as IL-1β increase the synthesis of both heavy and light subunits of ferritin [30]. In this Tanzanian cohort, PM was associated with elevated levels of IL-1 and TNF in maternal peripheral blood, particularly among first time mothers who are most likely to experience placental inflammation. Ferritin is widely used for determining iron deficiency anemia in industrialized countries, and therefore has the advantage of existing diagnostic platforms. For this reason, ferritin should also be evaluated in prospective studies as a cost-effective antenatal assay for screening inflammatory PM and poor pregnancy outcomes in tropical countries.

In summary, these data suggest that the peripheral IL-10 level may be useful as a biomarker of inflammation due to PM. Future studies should measure antenatal levels of IL-10, and assess its relationship to parasitemia and pregnancy outcomes, and its utility for monitoring interventional trials. The sensitivity and specificity of peripheral IL-10 levels at delivery suggest that they may not be sufficient to be used clinically as diagnostic tools. Additional biomarkers of PM, placental inflammation and PM-related poor outcomes are needed to improve the clinical management of this major public health problem.

Conflict of interest

The author(s) declare that they have no competing interests.

The authors gratefully acknowledge the participation of the mothers and their infants in the MOMS Project, and the work of the MOMS Project staff, including assistant medical officers, nurses, village health workers, laboratory technicians, microscopists, and data entry personnel. Gretchen Langdon of Institute of International Health, Brown University, organized the cytokine assays.

This work was supported by grants from Bill & Melinda Gates Foundation (grant 29202), NIH (R01 AI52059 and TW05509) and Puget Sound Partners for Global Health to P.E.D.

Authors’ Affiliations

Mother Offspring Malaria Studies (MOMS) Project, Seattle Biomedical Research Institute, Seattle WA 98109, and Muheza Designated District Hospital
Tumaini University
University of Washington
Brown University
National Institute for Medical Research

  1. Ismail MR, Ordi J, Menendez C, Ventura PJ, Aponte JJ, Kahigwa E, Hirt R, Cardesa A, Alonso PL: Placental pathology in malaria: a histological, immunohistochemical, and quantitative study. Human pathology. 2000, 31 (1): 85-93. 10.1016/S0046-8177(00)80203-8.View ArticlePubMedGoogle Scholar
  2. Fried M, Duffy PE: Adherence of Plasmodium falciparum to chondroitin sulfate A in the human placenta. Science. 1996, 272 (): 1502-1504. 10.1126/science.272.5267.1502.View ArticlePubMedGoogle Scholar
  3. Bulmer JN, Rasheed FN, Francis N, Morrison L, Greenwood BM: Placental malaria. I. Pathological classification. Histopathology. 1993, 22 (3): 211-218. 10.1111/j.1365-2559.1993.tb00110.x.View ArticlePubMedGoogle Scholar
  4. Duffy PE: Immunity to malaria during pregnancy: different host, different parasite: London, New York.Edited by: Duffy PEFM. 2001, Taylor & Francis, 71-126. 1st,Google Scholar
  5. Fried M, Muga RO, Misore AO, Duffy PE: Malaria elicits type 1 cytokines in the human placenta: IFN-gamma and TNF-alpha associated with pregnancy outcomes. J Immunol. 1998, 160 (5): 2523-2530.PubMedGoogle Scholar
  6. Mockenhaupt FP, Ulmen U, von Gaertner C, Bedu-Addo G, Bienzle U: Diagnosis of placental malaria. Journal of clinical microbiology. 2002, 40 (1): 306-308. 10.1128/JCM.40.1.306-308.2002.PubMed CentralView ArticlePubMedGoogle Scholar
  7. Mockenhaupt FP, Bedu-Addo G, von Gaertner C, Boye R, Fricke K, Hannibal I, Karakaya F, Schaller M, Ulmen U, Acquah PA, Dietz E, Eggelte TA, Bienzle U: Detection and clinical manifestation of placental malaria in southern Ghana. Malaria journal. 2006, 5: 119-10.1186/1475-2875-5-119.PubMed CentralView ArticlePubMedGoogle Scholar
  8. Ostrowski SR, Shulman CE, Peshu N, Staalsoe T, Hoyer-Hansen G, Pedersen BK, Marsh K, Ullum H: Elevated plasma urokinase receptor predicts low birth weight in maternal malaria. Parasite immunology. 2007, 29 (1): 37-46. 10.1111/j.1365-3024.2006.00916.x.View ArticlePubMedGoogle Scholar
  9. Coutinho HM, McGarvey ST, Acosta LP, Manalo DL, Langdon GC, Leenstra T, Kanzaria HK, Solomon J, Wu H, Olveda RM, Kurtis JD, Friedman JF: Nutritional status and serum cytokine profiles in children, adolescents, and young adults with Schistosoma japonicum-associated hepatic fibrosis, in Leyte, Philippines. The Journal of infectious diseases. 2005, 192 (3): 528-536. 10.1086/430929.View ArticleGoogle Scholar
  10. Muehlenbachs A, Fried M, Lachowitzer J, Mutabingwa TK, Duffy PE: Genome-wide expression analysis of placental malaria reveals features of lymphoid neogenesis during chronic infection. J Immunol. 2007, 179 (1): 557-565.View ArticlePubMedGoogle Scholar
  11. . []
  12. de Waal Malefyt R, Abrams J, Bennett B, Figdor CG, de Vries JE: Interleukin 10(IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. The Journal of experimental medicine. 1991, 174 (5): 1209-1220. 10.1084/jem.174.5.1209.View ArticlePubMedGoogle Scholar
  13. Gazzinelli RT, Oswald IP, James SL, Sher A: IL-10 inhibits parasite killing and nitrogen oxide production by IFN-gamma-activated macrophages. J Immunol. 1992, 148 (6): 1792-1796.PubMedGoogle Scholar
  14. Silva JS, Morrissey PJ, Grabstein KH, Mohler KM, Anderson D, Reed SG: Interleukin 10 and interferon gamma regulation of experimental Trypanosoma cruzi infection. The Journal of experimental medicine. 1992, 175 (1): 169-174. 10.1084/jem.175.1.169.View ArticlePubMedGoogle Scholar
  15. Heinzel FP, Sadick MD, Mutha SS, Locksley RM: Production of interferon gamma, interleukin 2, interleukin 4, and interleukin 10 by CD4+ lymphocytes in vivo during healing and progressive murine leishmaniasis. Proceedings of the National Academy of Sciences of the United States of America. 1991, 88 (16): 7011-7015. 10.1073/pnas.88.16.7011.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Sher A, Fiorentino D, Caspar P, Pearce E, Mosmann T: Production of IL-10 by CD4+ T lymphocytes correlates with down-regulation of Th1 cytokine synthesis in helminth infection. J Immunol. 1991, 147 (8): 2713-2716.PubMedGoogle Scholar
  17. Bogdan C, Vodovotz Y, Nathan C: Macrophage deactivation by interleukin 10. The Journal of experimental medicine. 1991, 174 (6): 1549-1555. 10.1084/jem.174.6.1549.View ArticlePubMedGoogle Scholar
  18. Rockett KA, Awburn MM, Cowden WB, Clark IA: Killing of Plasmodium falciparum in vitro by nitric oxide derivatives. Infect Immun. 1991, 59 (): 3280-3283.PubMed CentralPubMedGoogle Scholar
  19. Wenisch C, Parschalk B, Narzt E, Looareesuwan S, Graninger W: Elevated serum levels of IL-10 and IFN-gamma in patients with acute Plasmodium falciparum malaria. Clinical immunology and immunopathology. 1995, 74 (1): 115-117. 10.1006/clin.1995.1017.View ArticlePubMedGoogle Scholar
  20. Gosi P, Khusmith S, Looareesuwan S, Sitachamroom U, Glanarongran R, Buchachart K, Walsh DS: Complicated malaria is associated with differential elevations in serum levels of interleukins 10, 12, and 15. The Southeast Asian journal of tropical medicine and public health. 1999, 30 (3): 412-417.PubMedGoogle Scholar
  21. Suguitan AL, Leke RG, Fouda G, Zhou A, Thuita L, Metenou S, Fogako J, Megnekou R, Taylor DW: Changes in the levels of chemokines and cytokines in the placentas of women with Plasmodium falciparum malaria. The Journal of infectious diseases. 2003, 188 (7): 1074-1082. 10.1086/378500.View ArticlePubMedGoogle Scholar
  22. Kurtzhals JA, Adabayeri V, Goka BQ, Akanmori BD, Oliver-Commey JO, Nkrumah FK, Behr C, Hviid L: Low plasma concentrations of interleukin 10 in severe malarial anaemia compared with cerebral and uncomplicated malaria. Lancet. 1998, 351 (9118): 1768-1772. 10.1016/S0140-6736(97)09439-7.View ArticlePubMedGoogle Scholar
  23. Othoro C, Lal AA, Nahlen B, Koech D, Orago AS, Udhayakumar V: A low interleukin-10 tumor necrosis factor-alpha ratio is associated with malaria anemia in children residing in a holoendemic malaria region in western Kenya. The Journal of infectious diseases. 1999, 179 (1): 279-282. 10.1086/314548.View ArticlePubMedGoogle Scholar
  24. Hugosson E, Montgomery SM, Premji Z, Troye-Blomberg M, Bjorkman A: Higher IL-10 levels are associated with less effective clearance of Plasmodium falciparum parasites. Parasite immunology. 2004, 26 (3): 111-117. 10.1111/j.0141-9838.2004.00678.x.View ArticlePubMedGoogle Scholar
  25. Fried M, Domingo GJ, Gowda CD, Mutabingwa TK, Duffy PE: Plasmodium falciparum: chondroitin sulfate A is the major receptor for adhesion of parasitized erythrocytes in the placenta. Experimental parasitology. 2006, 113 (1): 36-42. 10.1016/j.exppara.2005.12.003.View ArticlePubMedGoogle Scholar
  26. Urban BC, Cordery D, Shafi MJ, Bull PC, Newbold CI, Williams TN, Marsh K: The frequency of BDCA3-positive dendritic cells is increased in the peripheral circulation of Kenyan children with severe malaria. Infection and immunity. 2006, 74 (12): 6700-6706. 10.1128/IAI.00861-06.PubMed CentralView ArticlePubMedGoogle Scholar
  27. Rogerson SJ, Brown HC, Pollina E, Abrams ET, Tadesse E, Lema VM, Molyneux ME: Placental tumor necrosis factor alpha but not gamma interferon is associated with placental malaria and low birth weight in Malawian women. Infection and immunity. 2003, 71 (1): 267-270. 10.1128/IAI.71.1.267-270.2003.PubMed CentralView ArticlePubMedGoogle Scholar
  28. Das BS, Thurnham DI, Das DB: Influence of malaria on markers of iron status in children: implications for interpreting iron status in malaria-endemic communities. The British journal of nutrition. 1997, 78 (5): 751-760. 10.1079/BJN19970192.View ArticlePubMedGoogle Scholar
  29. Taylor PG, Martinez-Torres C, Mendez-Castellano H, Bosch V, Leets I, Tropper E, Layrisse M: The relationship between iron deficiency and anemia in Venezuelan children. The American journal of clinical nutrition. 1993, 58 (2): 215-218.PubMedGoogle Scholar
  30. Rogers JT, Bridges KR, Durmowicz GP, Glass J, Auron PE, Munro HN: Translational control during the acute phase response. Ferritin synthesis in response to interleukin-1. The Journal of biological chemistry. 1990, 265 (24): 14572-14578.PubMedGoogle Scholar

© Kabyemela et al; licensee BioMed Central Ltd. 2008

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.