Skip to main content

Advertisement

Table 1 Polymerase Chain Reaction for amplification of fragments containing pfcrt and pfmdr1 gene polymorphisms

From: Molecular characterisation of drug-resistant Plasmodium falciparum from Thailand

Primer Sequence (5' → 3') PCR
Pfcrt 76   
1st round sense CAAGAAGGAAGTAAGTATCCAAAAATGG 94°C, 30''; 56°C, 30''; 60°C, 60''; 45 cycles
Antisense GTAGTTCTTGTAAGACCTATGAAGGC  
Nested sense GCAAAAATGACGAGCGTTATAGAG 94°C, 30''; 59°C, 30''; 60°C, 60''; 45 cycles
Antisense CTGAACAGGCATCTAACATGGATATAGC  
Pfmdr1 86   
Sense ATGGGTAAAGAGCAGAAAGAG 94°C, 30''; 53°C, 30''; 68°C, 60''; 10 cycles, followed by 94°C, 30''; 50°C, 30''; 68°C, 60'', 35 cycles
Antisense CGTACCAATTCCTGAACTCAC  
Pfmdr1 1042   
1st round sense TATGTCAAGCGGAGTTTTTGC 94°C, 30''; 50°C, 30''; 68°C, 60''; 45 cycles
Antisense TCTGAATCTCCTTTTAAGGAC  
Semi-nested sense GTAAATGCAGCTTTATGGG 94°C, 30''; 50°C, 30''; 68°C, 60''; 45 cycles
Antisense TCTGAATCTCCTTTTAAGGAC  
Pfmdr1 1246   
Sense CTACAGCAATCGTTGGAGAAA 94°C, 30''; 53°C, 30''; 68°C, 60''; 10 cycles, followed by 94°C, 30''; 50°C, 30''; 68°C, 60'', 35 cycles
Antisense GCTCTAGCTATAGCTATTCTC