Skip to main content

Table 1 Primers used in this study

From: Specific, sensitive and rapid detection of human plasmodium knowlesi infection by loop-mediated isothermal amplification (LAMP) in blood samples

Primer Sequence (5'→3')
FIP TTACAAACGTAAAAGTTGCAGGTACGATAAGGAGAGTATCAAATGTCCA
BIP CTGTGTAGAGAAGAGAGCAGAAATTCCGGATTTTCATAATCCTCC
F3 GCCAAGGATATTTATCTCCAC
B3 CTTCTTCTTATGTTTGCCGT
Loop-F GGAAATGTGTTCAGGCTCAC
Loop-B CATAAAGGAAGAATTTAA