Skip to main content

Table 1 Primers and profiles used for PCR-RFLP of the tlr-4, tlr-9 and tirap genes

From: Genetic variation of TLR-4, TLR-9 and TIRAP genes in Iranian malaria patients

    Temperature °C/time (min)    
Genes Primer Sequence A E D C Product size (bp) Restriction Enzyme Cut Product Size (bp)
  299TLR4F ATACTTAGACTACTACCTCC ATG 56
(1)
72
(1)
94
(1)
35 213 NcoI (Fermentase) G: 19 + 194
tlr-4* 299TLR4R TTGTTGGAAGTGAAAGTAAG        
  399TLR4F TGTTATCAAAGTGATTTTGGGAG AA 54
(1)
65
(1)
94
(1)
35 185 Hinf I (Fermentase) I: 162 + 23
  399TLR4R AGGTAAATGAGGTTTCTGAGTGATAGG        
  -1237TLR9F TTCATTCAGCCTTCACTCAG        T: 264+145+126+23
tlr-9 -1237TLR9R TCAAAGCCACAGTCCACAG 64
(1)
72
(1)
94
(1)
30 558 BslI (Fermentase) C: 264+115+126+ 30+23
  -1486TLR9F TTCATTCAGCCTTCACTCAG 64
(1)
72
(1)
94
(1)
30 558 AflII (Fermentase) T: 413 + 145
  -1486TLR9R TCAAAGCCACAGTCCACAG        
  180 TIRAP F AGTGCTGTACCATCGA CCTGCTG        
tirap ** 180 TIRAP R TTCCCCTTCTCCCTCCTGTAGTAG 60
(1)
72
(1)
94
(1)
35 161 Eam1105I (Fermentase) S: 141 + 20
  1. All primers described in this study were designed in our laboratory (GenBank accession no. AF177765.1 for tlr-4; NW-001838877.2 for tlr-9 and NT-033899.7 for tirap) except 299TLR4F primer that was described previously [26]. The bold and underline nucleotides located in the 3' of forward primers indicate a mutation, and create a restriction site accordingly.
  2. A: Annealing, E: Extension, D: Denaturation, C: No. of cycles
  3. * tlr-4 (gat) D299G (ggt)
  4. * tlr-4 (acc) T399I (atc)
  5. ** tirap (tcg) S180L (ttg)