Skip to main content

Table 1 Name, sequence and amplicon sizes generated by Plasmodium falciparum msp1, msp2 and glurp PCR amplification primers

From: Plasmodium falciparum msp1, msp2 and glurp allele frequency and diversity in sub-Saharan Africa

Gene Amplification Primer Primer sequence
msp1 Primary M1OR 5'cttaaatagtattctaattcaagtggatca 3'
   MIOF 5'ctagaagctttagaagatgcagtattg 3'
  Secondary MKR 5'gcttgcatcagctggagggcttgcaccaga 3'
   MKF 5'aaatgaagaagaaattactacaaaaggtgc 3'
  Secondary M1MR 5'atctgaaggatttgtacgtcttgaattacc 3'
   M1MF 5'aaatgaaggaacaagtggaacagctgttac 3'
  Secondary M1RF 5'taaaggatggagcaaatactcaagttgttg 3'
   RO33R2 5'caagtaattttgaactctatgttttaaatcagcgta 3'
msp2 Primary S2 5'-gaaggtaattaaaacattgtc 3'
   S3 5'-gagggatgttgctgctccacag 3'
  Secondary S1TAIL FW 5'-gcttataatatgagtataaggagaa 3'
   M5-FC27-RV 6FAM 5'-gcattgccagaacttgaa 3'
   N5-3D7-RV VIC 5'-ctgaagaggtactggtaga 3'
glurp Primary GF3 5'acatgcaagtgtgatcctgaa 3'
   GF4* 5'tgtaggtaccacgggttcttgtgg 3'
  Secondary GNF 5'tgttcacactgaacaattagatttagatca 3'
  1. Note: * used also for as reverse primer in the secondary amplification.