Skip to main content

Table 2 Primer sequences used for nested PCR protocol and sequencing

From: Evaluation of dihydrofolate reductase and dihydropteroate synthetase genotypes that confer resistance to sulphadoxine-pyrimethamine in Plasmodium falciparum in Haiti

Gene Primer Sequence Nucleotide location  
dhfr PCR1 M1* TTTATGATGGAACAAGTCTGC −3 to 18
   M5* AGTATATACATCGCTAACAGA 625 to 645
PCR2 M3* TTTATGATGGAACAAGTCTGCGACGTT −3 to 24
F/* AAATTCTTGATAAACAACGGAACCTTTTA 491 to 519
dhps PCR1 R2* AACCTAAACGTGCTGTTCAA 223 to 242
   R/* AATTGTGTGATTTGTCCACAA 913 to 933
PCR2 K* TGCTAGTGTTATAGATATAGGATGAGCATC 269 to 298
K/* CTATAACGAGGTATTGCATTTAATGCAAGAA 676 to 706
Seq Kb ATTGGTTTCGCATCACATTT 408 to 427
  1. ‡Primer sequences listed as forward primer first followed by reverse primer. All primers listed 5’ to 3’.
  2. *Primers taken from Duraisingh et al.[27].
  3. †Primer designed for nested sequencing of dhps codon 436 and 437.