Skip to main content

Advertisement

Table 1 Overview of the primer sequences and used concentrations in the PCR-NALFIA reaction

From: Development, validation and evaluation of a rapid PCR-nucleic acid lateral flow immuno-assay for the detection of Plasmodium and the differentiation between Plasmodium falciparum and Plasmodium vivax

   Target Primer type Sequence Product size (bp) Concentration in PCR mix (nM)
GAPDH Forward Biotin-5’ TGCACCACCAACTGCTTAGC -3’ 90 75
GAPDH Reverse Texas Red-5’ GGCATGGACTGTGGTCATGAG -3’   75
Pan-Plasmodium Forward Digoxigenin-5’ TCAGATACCGTCGTAATCTTA -3’ 180 50
Pan-Plasmodium Reverse * Biotin-5’- AACTTTCTCGCTTGCGCG -3’   900
P. falciparum Forward FAM-5’ GTCATCTTTCGAGGTGACTT -3’ 100 200
P. vivax Forward DNP-5’ TTTCTCTTCGGAGTTTATTC -3’ 100 650
  1. * This primer was used as a reverse primer for the P. falciparum and P. vivax reaction as well.