Skip to main content

Advertisement

Table 1 Primers for nested PCR of Plasmodium 18S rRNA gene

From: Correlates of HIV and malaria co-infection in Southern India

Species Primer Sequence Size of PCR product (bp)
Plasmodium sp. rPLU5 CCTGTTGTTGCCTTAAACTTC 1,200
  rPLU6 TTAAAATTGTTGCAGTTAAAACG  
P. falciparum rFAL1 TTAAACTGGTTTGGGAAAACCAAATATATT 205
  rFAL2 ACACAATGAACTCAATCATGACTACCCGTC  
P. vivax rVIV1 CGCTTCTAGCTTAATCCACATAACTGATAC 120
  rVIV2 ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA