Skip to main content

Table 1 PCR/RFLP profiles used for genotyping of the pfatpase6 gene

From: Molecular assessment of atpase6 mutations associated with artemisinin resistance among unexposed and exposed Plasmodium falciparum clinical isolates to artemisinin-based combination therapy

PCR Reaction RFLP Reaction
Reaction Primer Sequence (5′→3′) Ann (Time) Size Position Restriction Enzyme Product Size
(bp)   (bp)
Nest-1A F: TTGGTAATAAAACTCCCGC 58 (2’) 948 - - - -
Nest-2A F: TCATCTACCGCTATTGTATG 60 (1’) 775 L263E Apo I L: 775 E: 633+142
R: TCCTCTTAGCACCACTCC E431K MBoII E: 299+241+117+69+49 K: 416+241+69+49
Nest-1B F: AAGAAGGATAAATCACCAAG 55 (1’) 725 - - - -
Nest-2Ba F: TAACCATTCTAATTATACTACAGCg CAGG 60 (1’) 141 A623E Cac8 I A: 114+27 E: 141
Nest-2Bb F: AGAACAtTTAGCTTTGCTTATAAAAAAc TAA 60 (1’) 164 S769N DdeI S: 136+28 N: 164