Skip to main content

Advertisement

Table 2 Sequences of oligonucleotide primers and cycling conditions used for full-length pfatpase6 sequencing

From: Molecular assessment of atpase6 mutations associated with artemisinin resistance among unexposed and exposed Plasmodium falciparum clinical isolates to artemisinin-based combination therapy

Primer Sequence (5′→3′) Ann (min) Size (bp)
F1: ATTATATCTTTGTCATTCGTG 55 (1’) 840
R1: TTGTAAAGGTGTTTGAGTATC
F2: TCATCTACCGCTATTGTATG 60 (1’) 775
R2: TCCTCTTAGCACCACTCC
F3: AAGTGTTGAGACGTTAGGATG 55 (1’) 698
R3: TTGATGATTGTACAGGTGTTG
F4: TGGAGACAGTACCGAATTAGC 60 (1’) 814
R4: TCTTCCTACATATTTACGTGGTG
F5: ATTGTAAAGGTGCACCTGAG 60 (1’) 922
R5: TTACCTAGTGCTGTTGCTGG
F6: TAGTAATATAGGAGAAGTTGC 60 (1’) 578
R6: TGTATGTTTGTGTGTGTGC
F7: ATCCACCAGAACATGACG 60 (1’) 760
R7: TCTTGGTTCTTTGCTCTTC