Skip to main content

Advertisement

Table 1 Primer sequences for PCR amplification of the five molecular markers

From: Genetic diversity of Plasmodium vivax and Plasmodium falciparum in Honduras

Pvama-1   5′–CCAGCTGGAAGATGTCCTGT–3′ (F)
5′–TAATCCGAACTTGGCGTTTC–3′ (R)
Pvcsp Primary 5′–ATGTAGATCTGTCCAAGGCCATAAA–3′ (F)
5′–TAATTGAATAATGCTAGGACTAACAATATG–3′ (R)
Secondary 5′–GCAGAACCAAAAAATCCACGTGAAAATAAG–3′ (F)
5′–CCAACGGTAGCTCTAACTTTATCTAGGTAT–3′ (R)
Pvmsp-1 (F2) Primary 5′–GATGGAAAGCAACCGAAGAAGGGAAT–3′ (F)
   5′–AGCTTGTACTTTCCATAGTGGTCCAG–3′ (R)
  Secondary 5′–AAAATCGAGAGCATGATCGCCACTGAGAAG–3′ (F)
   5′–AGCTTGTACTTTCCATAGTGGTCCAG–3′ (R)
Pfmsp-1 Primary 5′–CTAGAAGCTTTAGAAGATGCAGTATTG–3′ (F)
   5′–CTTAAATAGATTCTAATTCAAGTGGATCA–3′ (R)
  Secondary K1 5′–AAATGAAGAAGAAATTACTACAAAAGGTGC–3′ (F)
   5′-GCTTGCATCAGCTGGAGGGCTTGCACCAGA–3′ (R)
  Secondary MAD20 5′–AAATGAAGGAACAAGTGGAACAGCTGTTAC–3′ (F)
   5′–ATCTGAAGGATTTGTACGTCTTGAATTACC–3′ (R)
  Secondary RO33 5′–TAAAGGATGGAGCAAATACTCAAGTTGTTG–3′ (F)
   5′–CAAGTAATTTTGAACTCTATGTTTTAAATCAGCGTA–3′ (R)
Pfmsp-2 Primary 5′–GAAGGTAATTAAAACATTGTC–3′ (F)
   5′–GAGGGATGTTGCTGCTCCACAG–3′ (R)
  Secondary FC27 5′–GCTTATAATATGAGTATAAGGAGAA–3′ (F)
   5′–GCATTGCCAGAACTTGAA–3′ (R)
  Secondary 3D7 5′–GCTTATAATATGAGTATAAGGAGAA –3′ (F)
   5′–CTGAAGAGGTACTGGTAGA–3′ (R)