Skip to main content

Table 1 Primer sequence and polymerase chain reaction (PCR) program for MSP1 and MSP2 amplification

From: Efficacy and tolerability of a new formulation of artesunate-mefloquine for the treatment of uncomplicated malaria in adult in Senegal: open randomized trial

Gene Name Primer sequence PCR program
msp 1 primary O1 5 CACATGAAAGTTATCAAGAACTTGTC 3 94°C-3 min, [94°C-25 sec, 50 °C-45 sec, 68°C-2 min] × 30, 72°C-3 min
O2 5′ GTACGTCTAATTCATTTGCACG 3
msp 1 nested N1 5 GCAGTATTGACAGGTTATGG 3 94°C-3 min, [94°C-30 sec, 50 °C-45 sec, 68°C-2 min] × 30, 72°C-3 min
N2 5 GATTGAAAGGTATTTGAC 3
msp2 primary S3 5 GAAGGTAATTAAAACATTGTC 3 94°C-3 min, [94°C-30 sec, 42′C-60 sec, 65°C-2 min] × 30, 72°C-3 min
S2 5 GAGGGATGTTGCTGCTCCACAG 3
msp2 nested S1 5 GAGTATAAGGAGAAGTATG 3 94°C-3 min, [94°C-30 sec, 50 °C-60 sec, 72°C-2 min] × 45, 72°C-3 min
  S4 5 CTAGAACCATGCATATGTCC 3