Skip to main content

Advertisement

Table 1 Published primers and probes used in analysis

From: Comparative evaluation of published real-time PCR assays for the detection of malaria following MIQE guidelines

Assay name Primer and Probe sets as published in 5—3 orientation Ref #
PLU3 F: GCTCTTTCTTGATTTCTTGGATG [14]
R: AGCAGGTTAAGATCTCGTTCG
P: ATGGCCGTTTTTAGTTCGTG
MACH F: ACATGGCTATGACGGGTAACG [10]
R: TGCCTTCCTTAGATGTGGTAGCTA
P: TCAGGCTCCCTCTCCGGAATCGA
CYTB F: TACTAACTTGTTATCCTCTATTCCAGTAGC [13]
R: CCTTTAACATCAAGACTTAATAGATTTGGA
P: G + TGC + TAC + CAT + GTA + AAT + GTAA
WHO F: CAGATGTCAGAGGTCAAATTCTAAGATT [12]
R: TCCCTTAACTTTCGTTCTTGATTAATG
P: CTGGAGACGGACTACTGCGAAAGCATTTG
FAL F: CTTTTGAGAGGTTTTGTTACTTTGAGTAA [7]
R: TATTCCATGCTGTAGTATTCAAACACAA
P: TGTTCATAACAGACGGGTAGTCATGATTGAGTTCA
PLASMO F: GTTAAGGGAGTGAAGACGATCAGA [11]
R: AACCCAAAGACTTTGATTTCTCATAA
P: ACCGTCGTAATCTTAACCATAAACTATGCCGACTAG
TURBO F: GTAATTGGAATGATAGGAATTTACAAGGT [9]
R: TCAACTACGAACGTTTTAACTGCAAC  
  P: TGCCAGCAGCCGCGGTAATTC  
  1. Primers and probes sequences as published. Forward and reverse primers are shown as F and R. All probes shown as P were labelled with 6-carboxy-fluorescein (FAM) as a reporter and 6-carboxy-tetramethylrhodamine (TAMRA) as a quencher to maintain uniformity. The last column shows the reference where primers and probe for each assay were obtained.