Name | Length (bases) | Sequence (5′ → 3′) | Utilities and description |
---|---|---|---|
JRTSΔ232-235 | 28 | AAAGAATCCC ATG G AACAAAATTGTATA | Sense strand PCR primer for the construction of pET-pf JRTSΔ232-235. Bold-face letters represent Met introduced in front of Glu236. Underlined sequence is the restriction site for Nco I. |
JRTSΔ232-251 | 28 | AAAGAATCCC ATGG AA AAGAATGATGAC | Sense strand PCR primer for the construction of pET-pf JRTSΔ232-251. Bold-face letters represent Met-Glu introduced infront of Lys252. Underlined sequence is the restriction site for Nco I. |
JRTSΔ232-265 | 28 | AAAGAATCCC ATG G AATTTTACAAAAAT | Sense strand PCR primer for the construction of pET-pf JRTSΔ232-265. Bold-face letters represent Met introduced in front of Glu266. Underlined sequence is the restriction site for Nco I. |
JRTSΔ232-271 | 28 | AAAGAATCCC ATG G ACAAATATAAAATT | Sense strand PCR primer for the construction of pET-pf JRTSΔ232-271. Bold-face letters represent Met introduced in front of Asp272. Underlined sequence is the restriction site for Nco I |
JRTSΔ232-274 | 57 | CCCCTCTAGA AATAATTTTGTTTAACTTTAAGAAGGAGATATACCATG AAAATTAAT | Sense strand PCR primer for theconstruction of pET-pf JRTSΔ232-274. Bold-face letters represent Met introduced in front of Lys275. Underlined sequence is the restriction site for Xba I |
JRTSΔ232-276 | 57 | CCCCTCTAGA AATAATTTTGTTTAACTTTAAGAAGGAGATATACCATG AATTATGAA | Sense strand PCR primer for the construction of pET-pf JRTSΔ232-276. Bold-face letters represent Met introduced in front of Asn277. Underlined sequence is the restriction site for Xba I |
JRTSΔ232-277 | 57 | CCCCTCTAGA AATAATTTTGTTTAACTTTAAGAAGGAGATATACCATG TATGAAAAT | Sense strand PCR primer to prepare construct pET-pf JRTSΔ232-277. Bold-face letters represent Met introduced in front of Tyr278. Underlined sequence is the restriction site for Xba I |
JRTSΔ232-299 | 28 | AAAGAATCCC ATG G AAGAGAAAAATAAA | Sense strand PCR primer to prepare construct pET-pf JRTSΔ232-299. Bold-face letters represent Met introduced in front of Glu300. Underlined sequence is the restriction site for Nco I |
N3TS | 22 | ACTCATGGATCC TTAAGCAGCC | Antisense strand PCR primer for the construction of all pET-pf JRTS mutants. Underlined sequence is the restriction site for BamH I |