Table 2 Primers used for construction of truncated bifunctional pf DHFR-TS
Name | Length (bases) | Sequence (5′ → 3′) | Utilities and description |
|---|---|---|---|
Δ229-277 Sense | 60 | ACAACATTGGATTTTATCATTTATAAGAAA TAT GAAAATGATGATGATGATGAAGAAGAA | Sense strand PCR primer for the construction of pf DHFR-TSΔ229-277. Lys228 (italic) was followed by Tyr278(bold) |
Δ229-277 Antisense | 60 | TTCTTCTTCATCATCATCATCATTTTCATATTTCTTATAAATGATAAAATCCAATGTTGT | Antisense strand PCR primer for the construction of pf DHFR-TSΔ229-277 |
Δ229-276 Sense | 60 | ACAACATTGGATTTTATCATTTATAAGAAA AAT TATGAAAATGATGATGATGATGAAGAA | Sense strand PCR primer for the construction of pf DHFR-TSΔ229-276. Lys228 (italic) was followed by Asn277(bold) |
Δ229-276 Antisense | 60 | TTCTTCATCATCATCATCATTTTCATAATTTTTCTTATAAATGATAAAATCCAATGTTGT | Antisense strand PCR primer to amplify pf DHFR-TSΔ229-276 |
Δ229-275 Sense | 60 | ACAACATTGGATTTTATCATTTATAAGAAA ATT AATTATGAAAATGATGATGATGATGAA | Sense strand PCR primer for the construction of pf DHFR-TSΔ229-275. Lys228 (italic) was followed by Ile276(bold) |
Δ229-275 Antisense | 60 | TTCATCATCATCATCATTTTCATAATTAATTTTCTTATAAATGATAAAATCCAATGTTGT | Antisense strand PCR primer to amplify pf DHFR-TSΔ229-275 |
Δ229-274 Sense | 60 | ACAACATTGGATTTTATCATTTATAAGAAA AAA ATTAATTATGAAAATGATGATGATGAT | Sense strand PCR primer for the construction of pf DHFR-TSΔ229-274. Lys228 (italic) was followed by Lys275(bold) |
Δ229-274 Antisense | 60 | ATCATCATCATCATTTTCATAATTAATTTTTTTCTTATAAATGATAAAATCCAATGTTGT | Antisense strand PCR primer to amplify pf DHFR-TSΔ229-274 |
Δ229-271 Sense | 60 | ACAACATTGGATTTTATCATTTATAAGAAA GAC AAATATAAAATTAATTATGAAAATGAT | Sense strand PCR primer for the construction of pf DHFR-TSΔ229-271. Lys228 (italic) was followed by Asp272(bold) |
Δ229-271 Antisense | 60 | ATCATTTTCATAATTAATTTTATATTTGTCTTTCTTATAAATGATAAAATCCAATGTTGT | Antisense strand PCR primer to amplify pf DHFR-TSΔ229-271 |
Δ229-265 Sense | 60 | ACAACATTGGATTTTATCATTTATAAGAAA GAA TTTTACAAAAATGTAGACAAATATAAA | Sense strand PCR primer for the construction of pf DHFR-TSΔ229-265. Lys228 (italic) was followed by Glu266(bold) |
Δ229-265 Antisense | 60 | TTTATATTTGTCTACATTTTTGTAAAATTCTTTCTTATAAATGATAAAATCCAATGTTGT | Antisense strand PCR primer to amplify pf DHFR-TSΔ229-265 |