Skip to main content

Table 1 Primers used in this study

From: Association of the endothelial protein C receptor (PROCR) rs867186-G allele with protection from severe malaria

Product Primer name Primer sequence
PCR 1 PCR 1 F GAGAAGGGAAAAGGCAGGTC
  PCR 1 R TGCCTGCCCTGTAGAGAGAT
PCR 2 PCR 2 F CCTCGAGGTAGGGGGTTATT
  PCR 2 R CACCCAGCAATCTTCAAAGG
PCR 3 PCR 3 F TCATGTTCTTTTCCCCTTGG
  PCR 3 R CCATCCATTTGTCTGGAACC
PCR 4-1 PCR 4–1 F CACACGCAGCTTCAGTCAGT
  PCR 4–1 R TCCCATCCCAAGTCTGACAC
PCR 4-2 PCR 4–2 F TGGCCCATCCTCCAAAGACAG
  PCR 4–2 R CCAGAAATTTTGCAAAGTGGA