Skip to main content

Advertisement

Table 1 Primer pairs used to amplify and sequence pfcrt, pfmdr1 and pvmdr1

From: Return of chloroquine-sensitive Plasmodium falciparum parasites and emergence of chloroquine-resistant Plasmodium vivax in Ethiopia

Gene fragment Primer Name Primer sequence PCR cycling conditions
Pfcrt SNPs at OF P1 5′CCGTTAATAATAAATACACGCG 35 cycles of 94°C for 30 s; 56°C
Codon 72&76 OR P2 5′CGGATGTTACAAAACTATAGTCC for 30 s; and 62°C for 1 min;
  NF P3 5′-AGGTTCTTGTCTTGGTAAATTTGC 30 cycles of 94°C for 30 s; 56°C
  NR P4 5′-CAAAACTATAGTTACCAATTTTG for 30 s; and 65°C for 1 min;
Pfmdr1 SNPs at OF P5 5′-AGGTTGAAAAAGAGTTGAAC 30 cycles of 94°C for 30 s; 55°C
Codon 86&184 OR P6 5′-ATGACACCACAAACATAAAT for 30 s; and 65°C for 1 min;
  NF P7 5′-ACAAAAAGAGTACCGCTGAAT 30 cycles of 94°C 30 s; 60°C
  NR P8 5′-AAACGCAAGTAATACATAAAGTC for 30 s; and 65°C for 1 min;
Pfmdr1 SNPs at OF P9 5′-GTGTATTTGCTGTAAGAGCT 34 cycles of 94°C for 30 s; 55°C
Codon 1034 OR P10 5′-GACATATTAAATAACATGGGTTC for 1 min and 72°C for 1.5
1042 and 1246 NF P11 5′ CAGATGATGAAATGTTTAAAGATC 29 cycles of 94°C for 30 s; 60°C
  NR 12 5′-TAAATAACATGGGTTCTTGACT for 30 s; and 65°C for 1 min;
pvmdr1at codon OF P13 5′-GCGAACTCGAATAAGTACTCCCTCTA 45 cycles of 94°C for 5 min,
976 and 1076 OF P14 5′GGCGTAGCTTCCCGTAAATAAA 530C for 1 min and 720C for 1 min
  NF P15 5′-GGATTGCTGTCAGCACATATTAACA 45 cycles of 94°C for 5 min,
  NF P16 5′AGAGGGATTTCATAAAGTCATT 650C for 1 min and 720C for 1 min
  1. OF: Outer Forward; OR: Outer Nested; P1-P12: Primers; NF: Nested Forward; NR: Nested Reverse; bp: base pair; pfmdr1: Plasmodium falciparum multi-drug resistance 1; pfcrt: Plasmodium falciparum chloroquine resistance transporter; pvmdr1: Plasmodium. vivax multi-drug resistance 1.