Gene fragment | Primer Name | Primer sequence | PCR cycling conditions |
---|---|---|---|
Pfcrt SNPs at | OF P1 | 5′CCGTTAATAATAAATACACGCG | 35 cycles of 94°C for 30 s; 56°C |
Codon 72&76 | OR P2 | 5′CGGATGTTACAAAACTATAGTCC | for 30 s; and 62°C for 1 min; |
 | NF P3 | 5′-AGGTTCTTGTCTTGGTAAATTTGC | 30 cycles of 94°C for 30 s; 56°C |
 | NR P4 | 5′-CAAAACTATAGTTACCAATTTTG | for 30 s; and 65°C for 1 min; |
Pfmdr1 SNPs at | OF P5 | 5′-AGGTTGAAAAAGAGTTGAAC | 30 cycles of 94°C for 30 s; 55°C |
Codon 86&184 | OR P6 | 5′-ATGACACCACAAACATAAAT | for 30 s; and 65°C for 1 min; |
 | NF P7 | 5′-ACAAAAAGAGTACCGCTGAAT | 30 cycles of 94°C 30 s; 60°C |
 | NR P8 | 5′-AAACGCAAGTAATACATAAAGTC | for 30 s; and 65°C for 1 min; |
Pfmdr1 SNPs at | OF P9 | 5′-GTGTATTTGCTGTAAGAGCT | 34 cycles of 94°C for 30 s; 55°C |
Codon 1034 | OR P10 | 5′-GACATATTAAATAACATGGGTTC | for 1 min and 72°C for 1.5 |
1042 and 1246 | NF P11 | 5′ CAGATGATGAAATGTTTAAAGATC | 29 cycles of 94°C for 30 s; 60°C |
 | NR 12 | 5′-TAAATAACATGGGTTCTTGACT | for 30 s; and 65°C for 1 min; |
pvmdr1at codon | OF P13 | 5′-GCGAACTCGAATAAGTACTCCCTCTA | 45 cycles of 94°C for 5 min, |
976 and 1076 | OF P14 | 5′GGCGTAGCTTCCCGTAAATAAA | 530C for 1 min and 720C for 1 min |
 | NF P15 | 5′-GGATTGCTGTCAGCACATATTAACA | 45 cycles of 94°C for 5 min, |
 | NF P16 | 5′AGAGGGATTTCATAAAGTCATT | 650C for 1 min and 720C for 1 min |