Skip to main content

Advertisement

Table 1 Sequences of oligonucleotide primers used to genotype msp-1 block 2 allelic types of Plasmodium falciparum isolates from Mauritania

From: Polymorphism of the merozoite surface protein-1 block 2 region in Plasmodium falciparum isolates from Mauritania

Amplification/Primer Sequence Polymorphism
Outer PCR   
Msp1F 5′AAGCCTTAGAAGATGCAGTATTGAC3′ Conserved
Msp1R 5′ATTCATTAATTTCTTCATATCCATTATC3′  
Nested PCR   
K1F 5′AAGAAATTACTACAAAAGGTG3′ K1 family specific
K1R 5′TGCATCAGCTGGAGGGCTTGCACCAC3′ K1 family specific
Ro33F 5′AGGATTTGCAGCACCTGGAGATCT3′ Ro33 family specific
Ro33R 5′GAGCAAATACTCAAGTTGTTGCA3′ Ro33 family specific
Mad20F 5′TGAATTATCTGAAGGATTTGTACGTC3′ Mad20 family specific
Mad20R 5′GAACAAGTCGAACAGCTGTTA3′ Mad20 family specific