Skip to main content

Advertisement

Table 1 LAMP Primers targeting Plasmodium 18 s ribosomal RNA

From: A reliable and rapid method for molecular detection of malarial parasites using microwave irradiation and loop mediated isothermal amplification

Plasmodium spp. Primers Sequence 5′ - 3′
Core primers FIP TCGAACTCTAATTCCCCGTTACCTATCAGCTTTTGATGTTAGGGT
  BIP CGGAGAGGGAGCCTGAGAAATAGAATTGGGTAATTTACGCG
  F3 GTATCAATCGAGTTTCTGACC
  B3c CTTGTCACTACCTCTCTTCT
Loop primers LPF CGTCATAGCCATGTTAGGCC
  LPB AGCTACCACATCTAAGGAAGGCAG
P. falciparum Primers Sequence 5′ - 3′
Core primers FIP AGCTGGAATTACCGCGGCTG GGTTCCTAGAGAAACAATTGG
  BIP TGTTGCAGTTAAAACGTTCGTAGCCCAAACCAGTTTAAATGAAAC
  F3 TGTAATTGGAATGATAGGAATTTA
  B3c GAAAACCTTATTTTGAACAAAGC
Loop primers LPF GCACCAGACTTGCCCT
  LPB TTGAATATTAAAGAA