Skip to main content

Advertisement

Table 1 Gene-specific primers and conditions used for dsRNA synthesis

From: Mosquito Akirin as a potential antigen for malaria control

Gene (accession number) Upstream/downstream primer sequence (5’-3’) Fragment size (bp) PCR annealing conditions
  TAATACGACTCACTATAGGGTACTTTGGCAGTCGTTGTAGTTGC   
Mosquito akirin (AGAP006809)   509 52°C/1 min
  TAATACGACTCACTATAGGGTACTCACCTGCTTGAAGGTGAACA   
  TAATACGACTCACTATAGGGAGACACCCCCACTGAGACTGATACA   
Mouse B2m (NM_009735)   447 62°C/45 sec
  TAATACGACTCACTATAGGGAGACACCCCCACTGAGACTGATACA   
  1. T7 promoter sequences (5’-TAATACGACTCACTATAGGGTACT-3’) were included at the 5’-end for dsRNA synthesis.