Skip to main content

Advertisement

Table 1 Species-specific primers used for nested PCR and sequencing

From: Re-evaluation of microscopy confirmed Plasmodium falciparum and Plasmodium vivax malaria by nested PCR detection in southern Ethiopia

Malaria species Primer Primer sequence 5′-3′ Size (bp)
Plasmodium rPLU5 CCTGTTGTTGCCTTAAACTTC 1,100
rPLU6 TTAAAATTGTTGCAGTTAAAAC
P. falciparum rFAL1   250
rFAL2 ACACAATGAACTCAATCATGACTACCCGTC
P. vivax rVIV1 CGCTTCTAGCTTAATCCACATAACTGATAC 120
rVIV2 ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA
P. malariae rMAL1 ATAACATAGTTGTACGTTAAGAATAACCGC 144
rMAL2 AAAATTCCCATGCATAAAAAATTATACAAA
P. ovale rOVA1 ATCTCTTTTGCTATTTTTTAGTATTGGAGA 800
rOVA2 GAAAAGGACACATTAATTGTATCCTAGTG