Skip to main content

Table 1 Set of primer sequences used to characterize gene polymorphisms by Plasmodium falciparum and P . vivax

From: Plasmodium vivax and Plasmodium falciparum ex vivo susceptibility to anti-malarials and gene characterization in Rondônia, West Amazon, Brazil

Gene Codons Primer AT* (°C) PCR products (bp)
pfmdr1 86, 184 5′-GAGTTGAACAAAAAGAGTACCGCTGA-3′ 55 512
5′-TTTTTCCGTTAATTTATGTTTGTGGTGTCA-3′
1043, 1042 5′-TGTCAAGCGGAGTTTTTGCATTTAGT-3′ 299
5′-TGGTAGTTATGCTGGAAAATTAATGTCCT-3′
1246 5′-GGAGAAACAGGTAGTGGAAAATCAACTT-3′ 302
5′-TTTGGAAGAGAAGATGCAACATTGGAA-3
pvmdr1 976 5′-ACTCACTTTATAGTGCTCTTCCTTGTG-3′ 55 476
5′- GGACATCAACTTCCCGGCGT- 3′
pfcrt 72, 76 5′- acagATGGCTCACGTTTAGG -3′ 55 162
   5′- TTTTGTAACATCCGAAACTCACA -3′   
  1. *Annealing temperature.