Skip to main content

Table 1 Concordance of SNP and microsatelitte-based COI estimates in 21 clinical Plasmodium vivax samples

From: COIL: a methodology for evaluating malarial complexity of infection using likelihood from single nucleotide polymorphism data

Sample SNP barcode No. poly SNPs SNP estimated COI [95% CI] Max. posterior probability MS estimated COI No. poly MS SNP/ MS agree?
L066 CGTCGTACAGACCCATCCATCCGCTGCACCACGTAA 0 1 [1,1] 1 1 0 Yes
L099 CGCTNCACNAACCTATCCAGNCANTGNNNCNAGTAC 8 2 [2,2] 0.9994 2 2 Yes
N121 CGTCGCGCGGACCTGTCCGTCCGCTACGCTGAACGC 0 1 [1,1] 1 1 0 Yes
N188 CGCCGTACGGACTTGTCCGTTCGTTGCGCTGAATAC 0 1 [1,1] 1 1 0 Yes
N257 NGNNNNANNNNCTCANNNNGNNNCNNNGCCAAGNNC 21 3 [3,5] 0.5813 3 7 Yes
N315 CGNNNNGTAAACNCATCCNGNCGCTACGCNNAGNAN 11 2 [2,2] 0.9881 2 2 Yes
N426 CGNTNNATNNNCNCATNNNNCTNNNNCGNNNAGCAN 19 3 [2,4] 0.6174 3 6 Yes
N464 CGTCGCACGGACTCACCTGTTCGCTGCGCCGAGCAC 0 1 [1,1] 1 1 0 Yes
N471 CTCCGTACGGACTTGTCCGTCCGCTGCGCCAAGTAC 0 1 [1,1] 1 1 0 Yes
M396 CNCCGTNCGGACCCANNCANCCNCTNCGCCNNGNNN 12 2 [2,2] 0.972 2 1 Yes
J073 CGCTGCATNNACCTGNCNNGTCNCNNCGCCAAGTAC 8 2 [2,2] 0.9989 2 3 Yes
J116 CGTCATGTAGGCCTACCTGGCCGCTGCGTCACGTAC 0 1 [1,1] 1 1 0 Yes
J244 CGTTATATGGACCTACCCAGCTGCCGCGCCAAATAC 0 1 [1,1] 1 1 0 Yes
J255 CGCCGTGCGGACTTGCCCGTTCATTGCGCCAAGTAC 0 1 [1,1] 1 1 0 Yes
J268 CGCTATACAAACCCATCCGTTCACTGTGCCACGCAC 0 1 [1,1] 1 1 0 Yes
L285 CGCCGTGCNGACTNGTCCGTCCGCTGCNCCAAGCNC 4 1 [1,2] 0.7197 2 3 Partial
J096 NGCNGNACGGACTTGCCCGTCCGTTGCGCTGAATAC 3 1 [1,1] 0.9988 2 2 No
L110 CNCCGTACNNANTTNNCCGTCNGTTGNGCTGAATAC 8 2 [2,2] 0.999 1 0 No
N427 CGCTATACGAACTTACCTATCTGCTGCGCCAAGCGC 0 1 [1,1] 1 2 1 No
N492 CGTCGCACAAGCTCGTCCGGTCGTTGCGCTGAGTAC 0 1 [1,1] 1 2 1 No
N524 CGNCGTNTNAACCCNCCNGGCTNCCANNCTAAGNNC 10 2 [2,2] 0.9989 3 5 No
M496 CGCTGCATAAACCCATCTAGTTACTGCGCCACGTAC 0 1 [1,1] 1 2 1 No
J249 CTCCGCACAAACTCGTCCGTCTACTACGCCGAGCAC 0 1 [1,1] 1 2 2 No