Skip to main content

Advertisement

Table 1 Gene specific primers, cycles, product sizes and annealing temperatures.

From: Effect of sample size and P-value filtering techniques on the detection of transcriptional changes induced in rat neuroblastoma (NG108) cells by mefloquine

Accession # Cycles Product Size (bp) Annealing Temperature °C Forward Primer (5'– 3') Reverse Primer (5'-3')
X63594 30 485 56 CTGAAAGCTGGCTGTGATCC TCCGTGTCATAGCTCTCCTCA
U30186 25 416 56 CTGGAAGCCTGGTATGAGGA CGCCGTGTGGTCTCTACCT
AI75959 35 421 56 CACTGGGTAGGACACCCAAA CCAGAACGATGGACTTTTCG
AI237378 30 414 54 GGAGCAGCAGGCTCTAGGTT CTCGAGGAGCTAAAAGCCAAG
M15114 25 501 56 AGTGCCGTAGCTGATGGATG CCTACCCGTGGAGGTAGGTC
X54686 35 498 54 ATCAGACACAGGCGCATCTC TCCTCTTTAAAGGCGGAAGC
Tubulin 25 589 62 CACTTCCCTCTGGCCACTTA GTGAAAGCAGCACCTTGTGA