Skip to main content

Advertisement

Table 1 Method for detecting codon 268 mutations: primer sequences for outer and nested PCR (5' -> 3')

From: Different mutation patterns of atovaquone resistance to Plasmodium falciparum in vitro and in vivo: rapid detection of codon 268 polymorphisms in the cytochrome b as potential in vivo resistance marker

Primer Name Sequence
CYTb1 CTCTATTAATTTAGTTAAAGCACA
CYTb2 ACAGAATAATCTCTAGCACC
CYTb3 AGCAGTAATTTGGATATGTGGAGG
CYTb5 GGTTTACTTGGAACAGTTTTTAACAaTG *
CYTb6 TGAATGGTACTTTCTACCAgTT *
CYTb7 ACCTGAATGGTACTTTCTACaATaT *
  1. * Small letters indicate base changes to provide digest sites for restriction enzymes to distinguish wild type from mutations at codon 268