Skip to main content

Table 1 Primers and probes used in real-time PCR assay

From: A new method for detection of pfmdr1 mutations in Plasmodium falciparum DNA using real-time PCR

Pfmdr1   Oligonucleotide (5'--> 3') Tm**
86 F TGTATGTGCTGTATTATCAGGAGGAAC 63.1
  R AATTGTACTAAACCTATAGATACTAATGATAATATTATAGG 61.7
  Asn (wt*) probe 6FAM-ACCTAAATT CATGTTCTTT-MGB-NFQ 66.5
  Tyr (mut**) probe VIC-ACCTAAATA CATGTTCTTT-MGB-NFQ 65.8
184 F AAGATGGACAATTTCATGATAATAATCCT 59
  R AATACATAAAGTCAAACGTGCATTTTTTA 57.6
  Tyr (wt) probe 6FAM-CTTTTTAGGTTTATA TATTTGGT-MGB-NFQ 65.2
  Phe (mut) probe VIC-CTTTTTAGGTTTATT TATTTGGT-MGB-NFQ 65.9
1034 F AAAAAGAAGAATTATTGTAAATGCAGCTT 57.6
  R GGATCCAAACCAATAGGCAAAA 58.9
  Ser (wt) probe 6FAM-ATTCA GTCAAAGCGCT-MGB-NFQ 65.8
  Cys (mut) probe VIC-ATTCT GTCAAAGCGCT-MGB-NFQ 66.7
1042 F AAAAAGAAGAATTATTGTAAATGCAGCTT 57.6
  R TTTCCAGCATAACTACCAGTAAATATAAAAG 60.7
  Asn (wt) probe 6FAM-CAATTATTTATTA ATAGTTTTGC-MGB-NFQ 65.3
  Asp (mut) probe VIC-AATTATTTATTG ATAGTTTTGC-MGB-NFQ 64.8
  1. * Wild type (Asn86, Tyr1 84, Serl034 or Asnl042) sequence ** Mutant (Tyr86, Phe184, Cysl034 or Aspl042) sequence *** Melting temperature estimated by Primer press v2.0 For probes, the reporter dye is covalently attached at the 5'end (6FAM or VIC) with a minor groove binder (MGB) and non-fluorescent quencher (NFQ) covalently attached at the 3' end.