Skip to main content

Advertisement

Table 1 Oligonucleotide sequences used in the Hot Ligation

From: A simplified high-throughput method for pyrethroid knock-down resistance (kdr) detection in Anopheles gambiae

Description Oligo Name bp Positiona Oligo sequence 5' – 3' Modifications
Suspt. East kdr detector Kdr104L-DTe 311-15i ATTTGCATTACTTACGACTA 5' Biotin
Resist. East kdr detector Kdr104S-DTe 311-15i ATTTGCATTACTTACGACTG 5' Biotin
East kdr reporter Kdr104-RTe 291–310 AATTTCCTATCACTACAGTG 5' Phosphorylation 3' Fluorescein
Suspt. West kdr detector Kdr104L-DTw 312-16i AATTTGCATTACTTACGACT 5' Biotin
Resist. West kdr detector Kdr104F-DTw 312-16i AATTTGCATTACTTACGACA 5' Biotin
West kdr reporter Kdr104-RTw 292–311 AAATTTCCTATCACTACAGT 5' Phosphorylation 3' Fluorescein
  1. aUsing sequence from Martinez-Torres et al., as reference; i intron 2 position.