Skip to main content

Table 1 Primers used for genotyping P. vivax parasites.

From: Practical PCR genotyping protocols for Plasmodium vivax using Pvcs and Pvmsp1

Gene Primer Sequencea mM Mg2+ b Annealing °C b Cyclesb
    1st 2nd 1st 2nd 1st 2nd
Pvcs VCS-OF ATGTAGATCTGTCCAAGGCCATAAA 1   58   25  
  VCS-OR TAATTGAATAATGCTAGGACTAACAATATG 1   58   25  
  VCS-NF GCAGAACCAAAAAATCCACGTGAAAATAAG   1   62   30
  VCS-NR CCAACGGTAGCTCTAACTTTATCTAGGTAT   1   62   30
Pvmsp1 F1 VM1-O1R CCACTCCATGAAACTGAAGTGTTTA 2   68   25  
  VM1-N1F CGATATTGGAAAATTGGAGACCTTCATCAC 2 2 68 68 25 30
  VM1-N1R CTTTTGCGCCTCCTCCAGCTGGCTCGTGT   2   68   30
Pvmsp1 F2 VM1-O2F GATGGAAAGCAACCGAAGAAGGGAAT 1   50   25  
  VM1-O2R AGCTTGTACTTTCCATAGTGGTCCAG 1 1 50 64 25 35
  VM1-N2F AAAATCGAGAGCATGATCGCCACTGAGAAG   1   64   35
Pvmsp1 F3 VM1-3F CAAGCCTACCAAGAATTGATCCCCAA 1 66 42
  VM1-3R ATTACTTTGTCGTAGTCCTCGGCGTAGTCC 1 66 42
  1. a Sequences are provided 5'- to 3'-end.p
  2. b The two columns indicate conditions for the primary and secondary amplification reactions.