Skip to main content

Table 1 Primer sequence with corresponding annealing temperatures

From: Plasmodium yoelii 17XL infection up-regulates RANTES, CCR1, CCR3 and CCR5 expression, and induces ultrastructural changes in the cerebellum

Mouse Gene GenBank Accession Number Sequence (Forward) Sequence (Reverse) Annealing Temp (°C)
RANTES AF252285 GGAAATCTTCGCACCTCAAG GAGCGTGCGAACTTCTTGTT 55
CCR1 NM009912 CCACTCCATGCCAAAAGACT ATTAGGACATTGCCCACCAC 50
CCR3 NM009914 TATCATTACCTGGGGCCTTG CGAGGACTGCAGGAAAACTC 53
CCR5 D83648 CGAAAACACATGGTCAAACG GTTCTCCTGTGGATCGGGTA 52
GAPDH NM_008084 CACAATTTCATCCCAGACC GTGGGTGCAGCGAACTTTAT 55
\