Skip to main content

Table 1 PCR amplification of DNA fragments harbouring codon 76 of the pfcrt gene

From: Epidemiological characterization of Plasmodium falciparum in the Republic of Cabo Verde: implications for potential large-scale re-emergence of malaria

Primer pair (5'-3') Expected fragment size Cycling conditions Reagent concentrations
Outer
Sense (O1F)
CCTTGTCGACCTTAACAGATG
Antisense (N1R)
GACTGAACAGGCATCTAACATG
528 bps Hot Start: 94°C, 3'
40 cycles at:
denaturing: 94°C, 45"
annealing: 55°C, 45"
extension: 72°C, 45"
final extension: 72°C, 3'
1 μM/primer, 1 × PCR buffer (Promega ™), 2.5 mM MgCl2, 0.2 mM dNTP's, 0.025 U/μl of Promega ™ Taq DNA polymerase
Nested
Sense (N2F)
ATGGCTCACGTTTAGGTGG
Antisense (N2R)
CTTTTGAATTTCCCTTTTTATTTCC
271 bps Hot Start: 94°C, 3'
35 cycles at:
denaturing: 94°C, 45"
annealing: 53°C, 45"
extension: 72°C, 45"
final extension: 72°C, 3'
1 μM/primer, 1 × PCR buffer (Promega ™), 2.5 mM MgCl2, 0.2 mM dNTP's, 0.025 U/μl of Promega ™ Taq DNA polymerase