Skip to main content

Table 1 PCR amplification of DNA fragments harbouring codon 76 of the pfcrt gene

From: Epidemiological characterization of Plasmodium falciparum in the Republic of Cabo Verde: implications for potential large-scale re-emergence of malaria

Primer pair (5'-3')

Expected fragment size

Cycling conditions

Reagent concentrations

Outer

Sense (O1F)

CCTTGTCGACCTTAACAGATG

Antisense (N1R)

GACTGAACAGGCATCTAACATG

528 bps

Hot Start: 94°C, 3'

40 cycles at:

denaturing: 94°C, 45"

annealing: 55°C, 45"

extension: 72°C, 45"

final extension: 72°C, 3'

1 μM/primer, 1 × PCR buffer (Promega ™), 2.5 mM MgCl2, 0.2 mM dNTP's, 0.025 U/μl of Promega ™ Taq DNA polymerase

Nested

Sense (N2F)

ATGGCTCACGTTTAGGTGG

Antisense (N2R)

CTTTTGAATTTCCCTTTTTATTTCC

271 bps

Hot Start: 94°C, 3'

35 cycles at:

denaturing: 94°C, 45"

annealing: 53°C, 45"

extension: 72°C, 45"

final extension: 72°C, 3'

1 μM/primer, 1 × PCR buffer (Promega ™), 2.5 mM MgCl2, 0.2 mM dNTP's, 0.025 U/μl of Promega ™ Taq DNA polymerase