Skip to main content

Advertisement

Table 1 PCR amplification of DNA fragments harbouring codon 76 of the pfcrt gene

From: Epidemiological characterization of Plasmodium falciparum in the Republic of Cabo Verde: implications for potential large-scale re-emergence of malaria

Primer pair (5'-3') Expected fragment size Cycling conditions Reagent concentrations
Outer Sense (O1F) CCTTGTCGACCTTAACAGATG Antisense (N1R) GACTGAACAGGCATCTAACATG 528 bps Hot Start: 94°C, 3' 40 cycles at: denaturing: 94°C, 45" annealing: 55°C, 45" extension: 72°C, 45" final extension: 72°C, 3' 1 μM/primer, 1 × PCR buffer (Promega ™), 2.5 mM MgCl2, 0.2 mM dNTP's, 0.025 U/μl of Promega ™ Taq DNA polymerase
Nested Sense (N2F) ATGGCTCACGTTTAGGTGG Antisense (N2R) CTTTTGAATTTCCCTTTTTATTTCC 271 bps Hot Start: 94°C, 3' 35 cycles at: denaturing: 94°C, 45" annealing: 53°C, 45" extension: 72°C, 45" final extension: 72°C, 3' 1 μM/primer, 1 × PCR buffer (Promega ™), 2.5 mM MgCl2, 0.2 mM dNTP's, 0.025 U/μl of Promega ™ Taq DNA polymerase