Skip to main content

Table 1 Details of primers, primer and MgCl2 concentrations and cycle conditions for the amplification of PfWARP and Pfs28 genes. Oligonucleotide positions are based on NCBI Genebank sequence PfWARP (NC_004329) and Pfs28 (L25843).

From: Limited polymorphism in Plasmodium falciparum ookinete surface antigen, von Willebrand factor A domain-related protein from clinical isolates

Oligonucleotide Nucleotide sequence Description Primer (μM)/MgCl2 (mM) Cycle conditions
PfWARP_USF GTTGTTGTATAATAAGAGAGAGAAAAATG WARP bases 1221181 to 1221209 0.6/2.0 94°C 10 min (94°C 30 sec, 52°C 30 sec, 72°C 60 sec) 40 cycles, 72°C 5 min
PfWARP_IR TACATCTTATGATTTATTCTTATCACATA WARP bases 1222057 to 1222085   
PfWARP_IF GTGGTATTATGTTTGGGTATGATATCAGC WARP bases 1221222 to 1221250 0.6/1.5 94°C 10 min (94°C 30 sec, 52°C 30 sec, 72°C 60 sec) 25 cycles, 72°C 5 min
PfWARP_IR TACATCTTATGATTTATTCTTATCACATA WARP bases 1222057 to 1222085   
Pfs28_F1 ATGAATACATATTTTAAGGTACTTCTT Pfs28 bases 60 to 86 1.0/2.5 94°C 10 min (94°C 60 sec, 46°C 60 sec, 72°C 45 sec) 40 cycles, 72°C 10 min
Pfs28_R650 GAGCATACAATCAGAACGTGTGTTAGG Pfs28 bases 680 to 709   
Pfs28_F40 CAACTTTACATAACGTTGAATAAGGCTC Pfs28 bases 99 to 126 1.0/2.5 94°C 10 min (94°C 60 sec, 50°C 60 sec, 72°C 45 sec) 34 cycles, 72°C 10 min
Pfs28_R630 GCATACAATCAGAACGTGTGTTAG Pfs28 bases 666 to 689   
\