Skip to main content

Table 1 Polymorphic genes investigated, mutation sites, primers and primer sequences, PCR reaction conditions, restriction enzymes and control DNA used in this study

From: Drug resistance to sulphadoxine-pyrimethamine in Plasmodium falciparum malaria in Mlimba, Tanzania

Gene Mutation Primers Primer Sequences PCR conditions Enzyme digest Control DNA
DHFR Primary   M1
M5
5' TTTATGATGGAACAAGTCTGC3'
5' AGTATATACATCGCTAACAGA3'
94°C-3 min, 94°C-1 min, 50°C-2 min, 72°C-2 min, ×40, 72°C-10 min, 4°C-hold   
DHFR Nested N51I M3
F/
5'TTTATGATGGAACAAGTCTGCGACGTT3'
5'AAATTCTTGATAAACAACGGAACCTttTA3'
94°C-2 min, 94°C-1 min, 45°C-1 min, 72°C-2 min, ×35, 72°C-10 min, 4°C-hold TSP509 1 (+) K1
  C59R F
M4
5'GAAATGTAATTCCCTAGATATGGAATATT3'
5'TTAATTTCCCAAGTAAAACTATTAGAGCTTC3'
94°C-2 min, 94°C-1 min, 45°C-1 min, 72°C-2 min, ×35, 72°C-10 min, 4°C-hold Xmn I (+) T9/96
  S108N F
M4
5'GAAATGTAATTCCCTAGATATGGAATATT3'
5'TTAATTTCCCAAGTAAAACTATTAGAGCTTC3'
94°C-2 min, 94°C-1 min, 45°C-1 min, 72°C-2 min, ×35, 72°C-10 min, 4°C-hold Alu 1 (+) HB3
(+) T9/96
(+) FCR3
  I164L M3
F/
5'TTTATGATGGAACAAGTCTGCGACGTT3'
5'AAATTCTTGATAAACAACGGAACCTTTTA3'
94°C-2 min, 94°C-1 min, 45°C-1 min, 72°C-2 min, ×35, 72°C-10 min, 4°C-hold Dra I (+) V1/S (+) HB3
(+) DD2
DHPS Primary   R2
R/
5' AACCTAAACGTGCTGTTCAA3'
5' AATTGTGTGATTTGTCCACAA3'
94°C-3 min, 94°C-1 min, 50°C-2 min, 72°C-2 min, ×40, 72°C-10 min, 4°C-hold   
DHPS Nested A437G K
K/
5'TGCTAGTGTTATAGATATAGGATGAGcATC3'
5'CTATAACGAGGTATTGCATTTAATGCAAGAA3'
94°C-2 min, 94°C-1 min, 45°C-1 min, 72°C-2 min, ×35, 72°C-10 min, 4°C-hold Ava II (+) K1
(+) FCR3
  K540D K
K/
5'TGCTAGTGTTATAGATATAGGATGAGCATC3'
5'CTATAACGAGGTATTGCATTTAATGCAAGAA3'
94°C-2 min, 94°C-1 min, 45°C-1 min, 72°C-2 min, ×35, 72°C-10 min, 4°C-hold Fok I (+) TN-1
(+) VIS
(+) W2
  A581G L
L/
5'ATAGGATACTATTTGATATTGGACCAGGATTCG3'
5'TATTACAACATTTTGATCATTCGCGCAACCGG3'
94°C-2 min, 94°C-1 min, 45°C-1 min, 72°C-2 min, ×35, 72°C-10 min, 4°C-hold Bst UI (+) K1
(+) DD2
  1. Source: Duraisingh et al. [21]; Foley et al. [48]