Skip to main content

Table 1 Sequence of primers and probes used for Pfcrt and Pfmdr1 amplification and melting temperatures of the sensor probes of each allele

From: Rapid detection of Pfcrt and Pfmdr1 mutations in Plasmodium falciparum isolates by FRET and in vivo response to chloroquine among children from Osogbo, Nigeria

  Melting temperatures (°C) of the sensor probes
Sequence 5' to 3' Wild Mutant
Pfcrt   
Forward Primer: CTTGTCTTGGTAAATGTGCTCA   
iLC Primer: GTTACCAATTTTGTTTAAAGTTCT   
Sensor Probe: TGTGTAATTGAAACAATTTTTGCTAA 46.5 ± 0.2 65.3 ± 0.4
Pfmdr1   
Forward Primer: TGTATTATCAGGAGGAACATTACC   
Reverse Primer: ACCACCAAACATAAATTAACGGA   
Sensor Probe 86: ATTAATATCATCATAAATACATG 51.8 ± 0.3 56.5 ± 0.2
Anchor Probe 86: TCTTTAATATTACACCAAACACAGATAT   
Sensor Probe 184: TAAAAAATGCACGTTTGACTTTATGTATTA 53.0 ± 0.2 58.7 ± 0.3
Anchor Probe 184: CCTTTTTAGGTTTATTTATTTGGTCAT