Skip to main content

Table 1 Order-specific group primers and species-specific primers used in blood-meal identification

From: The resting sites and blood-meal sources of Anopheles minimus in Taiwan

Test animal Primer sequence1 (F: forward 5'-3' and R: reverse 5'-3') Annealing temp (°C) Size of amplified products (bp)
Avian F: GACTGTGACAAAATCCCNTTCCA
R: GGTCTTCATCTYHGGYTTACAAGAC
64 508
Mammalian F: CGAAGCTTGATATGAAAAACCATCGTTG
R: TGTAGTTRTCWGGGTCHCCTA
59 772
Chicken F: GGGACACCCTCCCCCTTAATGACA
R: GGAGGGCTGGAAGAAGGAGTG
69 266
Bovine F: GCCATATACTCTCCTTGGTGACA
R: GTAGGCTTGGGAATAGTACGA
61 271
Pig F: GCCTAAATCTCCCCTCAATGGTA
R: ATGAAAGAGGCAAATAGATTTTCG
64 212
Goat F: TTAAAGACTGAGAGCATGATA
R: ATGAAAGAGGCAAATAGATTTTCG
54 225
Cat F: TTCTCAGGATATACCCTTGACA
R: GAAAGAGCCCATTGAGGAAATC
60 180
Dog F: GAACTAGGTCAGCCCGGTACTT
R: CGGAGCACCAATTATTAACGGC
67 153
Horse F: CCCTAAGCCTCCTAATCCGT
R: AGGAATGATGGGGGAAGTAA
56 235
Human F: TTCGGCGCATGAGCTGGAGTCC R: TATGCGGGGAAACGCCATATCG 70 228
Monkey F: CCTCTTTCCTGCTGCTAATG
R: TTTGATACTGGGATATGGCG
62 222
Rat F: CGGCCACCCAGAAGTGTACATC R: GGCTCGGGTGTCTACATCTAGG 67 196
  1. 1The primer sequences were cited from papers of Ngo and Kramer [22], Lahiff et al [23] and Parodi et al [24].