Skip to main content

Table 1 Primer pairs of amplicons analysed by qRT-PCR

From: Co-ordinated stage-dependent enhancement of Plasmodium falciparum antioxidant enzymes and heat shock protein expression in parasites growing in oxidatively stressed or G6PD-deficient red blood cells

Gene Name Gene ID
(Entrez Nucleotide NCBI)
Gene ID
(Plasmo
DB)
(5' → 3') Primer Sequences Prod.
Tm
Ampl.
size
Effic.
    Forward Reverse °C (bp) (%)
18S rRNA M19172 MAL1_18s CAAGGAAGTTTAAGGCAACAACAG CATATCTTTCAATCGGTAGGAGCG 86 313 100.9
GAPDH AF030440 PF14_0598 TGGAATTGTTGAAGGTTTAATG CTGGAATAATGTTGGATAATGC 85.5 128 98.8
GPx Z68200 PFL0580w TCGATGCATGATGAAAATGGAACG AATCTAACGGGTTTGTTTTGGGTG 82 118 100.3
GR AF027825 PF14_0192 GTTTAGGTGGAACGTGTGTCAAC GGTGTCAAATCCGTAATGCCTGG 83.5 110 99.3
Grx AF276083 PFC0271c CCCATATTGTATTAAGGCAATT TTCTCAATGTTTTCTACATGC 79 78 100.3
GST AY014840 PF14_0187 GCTTGGAGATAATATAGTGTTATA CTATTCCAAGGTAGGCAAAA 78.5 86 100.2
1-Cys-Prx AF294425 PF08_0131 GGGCTATTTTATTTAGTCACCCAC TTGATCGTGAGATTCTTTGGAGTT 83 146 96.6
2-Cys-Prx AB037568 PF14_0368 TGGTAGATCAGTTGAGGAAGTCTT CACTAACACCTTCTTCTGATGGTT 85.5 131 97.4
TR X87095 PFI1170c ATGGTGCATGTGGATATTCAGAAG TGTCGATGAACAGCAGATATTTCC 80 177 99.8
SOD-1 Z49819 PF08_0071 TTGTGGTGGTGAGCCTCATGG CCCCAACCGGAACCAAAATGAC 82 84 100.1
SOD-2 AY586514 PFF1130c TTTAACCACAATTTCTTTTGGC CACTTCCAAAATGACCTGATG 78.7 151 98.7
Hsp601 U38963 PF10_0153 CCAGTCATCCTTATTAGTTATAGC CTATATCATGAATCAAGGCTTTTC 82.5 149 99.5
Hsp70–22 M18836 PFI0875w ATGCCAACCAATCATTGTTAAATT ATTCGTCACTATCTACATCTTCGT 84 89 100.5
Hsp70–33 AB050740 PF11_0351 TTAGTTGGTGGTATGACTAGAATG TTAATACACCTCCTTGTATAGCAG 83.5 133 100
Hsp754 M28261 PF08_0054 AATTTCCCAGGAGGTATGCCC TTCTTCAACTGTTGGTCCACTTC 90 75 97.9
Hsp905 X13014 PF07_0029 CATGACTAGCTATATGTTATCCAA AAGAGGTATCAAATAATAACCAGA 81.5 143 100.3
  1. 1PlasmoDB nomenclature (PDB): hsp60; 2 PDB: Heat shock protein (72 kDa); 3PDB: Heat shock protein hsp 70 kDa homologue (73 kDa); 4PDB: heat shock 70 kDa protein (75 kDa); 5PDB: heat shock protein 86.