Skip to main content
Figure 2 | Malaria Journal

Figure 2

From: Increased expression levels of the pvcrt-o and pvmdr1 genes in a patient with severe Plasmodium vivax malaria

Figure 2

Expression levels of chloroquine resistance genes in severe and mild Plasmodium vivax malaria. In panel A, nested PCR to identify Plasmodium species. Amplification of gDNA from P. falciparum 3D7 strain and P. vivax from severe patient, respectively, using specific P. vivax primers (lanes 1 and 2). Amplification of gDNA from P. falciparum 3D7 strain and P. vivax from severe patient, respectively, using specific P. falciparum primers (lanes 3 and 4). Molecular weight ladder (lane L). A positive reaction is noted when primers for P. falciparum and P. vivax produce amplification products of 205-bp and 120-bp, respectively [16]. Molecular weight in base-pairs (bp). In panel B, relative quantification of pvcrt-o and pvmdr1 transcripts in total RNA obtained from parasites from the severe patient vs total RNA obtained from parasites from a patient from Brazil with P. vivax and non-severe symptoms also presenting to our hospital. The following oligonucleotide primers were designed for the real-time experiments using the Primer Express program (Applied Biosystems). Primers: F-pvcrt-o RT 5'-ATGTCCAAGATGTGCGACGAT-3';R-pvcrt-o RT 5'-CTGGTCCCTGTATGCAACTGAC-3'; F-pvmdr1 RT 5'-AAGGATCAAAGGCAACCCA-3'; R-pvmdr1 RT5'-TCAGGTTGTTACTGCTGTTGCTATT-3'; F-pvtubulin RT 5' CCAAGAATATGATGTGTGCAAGTG 3'; R-pvtubulin RT 5' GGCGCAGGCGGTTAGG 3'.

Back to article page