Skip to main content

Advertisement

Table 1 Oligonucleotide primers for msp1 and msp2 genotyping and fluorescent modifications for the CE method

From: Optimization and validation of multi-coloured capillary electrophoresis for genotyping of Plasmodium falciparum merozoite surface proteins (msp1 and 2)

Primer sequencesa   Fluorophore modificationb
Segment-specific primers for block 2 of msp1 and block 3 of msp2
In the primary reaction
msp1 F 5'-CTAGAAGCTTTAGAAGATGCAGTATTG-3'  
msp1 R 5'-CTTAAATAGTATTCTAATTCAAGTGGATCA -3'  
msp2 F 5'-ATGAAGGTAATTAAAACATT GTCTATTATA-3'  
msp2 R 5'- CTTTGTTACCATCGGTACATTCTT-3'  
Allelic type-specific primers for msp1 in the nested reaction
K1 F 5'- AAATGAAGAAGAAATTACTACAAAAGGTGC-3' 7 bp-tail
K1 R 5'- GCTTGCATCAGCTGGAGGGCTTGCACCAGA-3' NED™ (yellow)
MAD 20 F 5'- AAATGAAGGAACAAGTGGAACAGCTGTTAC -3' 7 bp-tail
MAD 20 R 5'- ATCTGAAGGATTTGTACGTCTTGAATTACC'-3' PET® (red)
RO33 F 5'- TAAAGGATGGAGCAAATACTCAAGTTGTTG-3' 7 bp-tail
RO33 R 5'- CATCTGAAGGATTTGCAGCACCTGGAGATC-3' VIC® (green)
Allelic type-specific primers for msp2 in the nested reaction
FC27 F 5'- AATACTAAGAGTGTAGGTGCARATGCTCCA-3' 7 bp-tail
FC27 R 5'- TTTTAT TTG GTGCAT TGCCAGAAC TTG AAC-3' 6-FAM™ (blue)
IC c F 5'- AGAAGTATGGCAGAAAGTAAKCCTYCTACT-3' 7 bp-tail
ICc R 5'- GATTGTAATTCGGGGGATTCAGTTTGTTCG-3' VIC® (green)
  1. a Primer sequences according to the original method [7, 16]
  2. b Modification of the primers used in the CE-based method
  3. c Also referred to as 3D7 type
  4. F = forward R = reverse