Skip to main content

Advertisement

Table 1 Primers and probes for qPCR

From: Comparison of diagnostic methods for the detection and quantification of the four sympatric Plasmodium species in field samples from Papua New Guinea

Species Primer/ probe Sequence 5'-3' Fluorescent label
P. falciparum Fal_F TATTGCTTTTGAGAGGTTTTGTTACTTTG  
P. falciparum Fal_R ACCTCTGACATCTGAATACGAATGC  
P. falciparum Fal_P ACGGGTAGTCATGATTGAGTT FAM-BHQ
P. vivax Viv_F GCTTTGTAATTGGAATGATGGGAAT  
P. vivax Viv_R ATGCGCACAAAGTCGATACGAAG  
P. vivax Viv_P AGCAACGCTTCTAGCTTA HEX-BHQ
P.malariae Mal_F TGCCGACTAGGTGTTGGATGAT  
P.malariae Mal_R CTAGTGAGTTTCCCCGTGTTGAGT  
P.malariae Mal_P TGTTTCTTTTAGATAGCTTCCTTCAG FAM-BHQ
P. ovale Ova_F CCAGCTCCAATAGCGTATATTAAA  
P. ovale Ova_R ACACATTTTGSATAAGGAATGCAAAG*  
P. ovale Ova_P TATAAGATGCTTAGRCAATACAACGTATCTG* HEX-BHQ
  1. *Oligo includes a wobble (S: G or C; R: A or G)