Skip to main content

Advertisement

Table 1 Primers for preparation of mutant genes by site-directed mutagenesis

From: Epitope mapping of PfCP-2.9, an asexual blood-stage vaccine candidate of Plasmodium falciparum

Number Designation Directions Primer sequences (5' to 3')
01 M17   
   Forward CCATGTTCATTATTTAAAGATG
   Reverse CCTTCATAATTTCATCTTTAAATAATGAAC
02 M18   
   Forward CATGTTCATTATATAGAGATG
   Reverse CATCTCTATATAATGAACATG
03 M55   
   Forward CCGCTGATAATAAAGACTC
   Reverse CCGGAGTCTTTATTATCAG
04 M56   
   Forward CCGCTGATGATAGAGACTC
   Reverse CCGGAGTCTCTATCATCAG
05 M62   
   Forward CTTTAAAGTGTGCATGTGACCC
   Reverse GGGTCACATGCACACTTTAAAG
06 M71   
   Forward GGTTTCACAAACTACATGTCG
   Reverse CGACATGTAGTTTGTGAAACC
07 M81   
   Forward CTTTGTTTGTAAATGTATCGAAAGAAG
   Reverse CTTCTTTCGATACATTTACAAACAAG
08 M82   
   Forward CGTTTCTTTGTTTGTAAATGTGTCCAAAGAAG
   Reverse GCCCTTCTTTGGACACATTTACAAACAAAG
09 M84   
   Forward CGAAAGAAAGGCTGAAG
   Reverse CTTCAGCCTTTCTTTCG
10 M159   
   Forward GCAATGTCCAGAAAATTCTG
   Reverse CCAGAATTTTCTGGACATTG
11 M160   
   Forward GTCCACAAAGATCTGG
   Reverse CCAGATCTTTGTGGAC
12 M165   
   Forward CCGGTTTCAAACATTTAG
   Reverse CCGCTAAATGTTTGAAAC
13 M172   
   Forward GATGAAAGAGAATACTGTAAATG
   Reverse CATTTACAGTATTCTCTTTCATC
14 M174   
   Forward CCGGAATGTAGATGTTTG
   Reverse CCGCAAACATCTACATTCTTC
15 M176   
   Forward GTAAATGTAGGTTGAATTACAAACAAGAAGG
   Reverse CCTTCTTGTTTGTAATTCAACCTACATTTAC
16 M185   
   Forward GGTGATAGATGTGTTGAAAATCC
   Reverse CCGCAACACATCTATCACC
17 M188   
   Forward GTGTTTTAAATCCACAACC
   Reverse GGTTGTGGATTTAAAACAC
18 Universal   
   Forward CCCTCGAGAAAAGAGCTTTGTC
   Reverse CCGGAATTCCTATTAATGATGATG