Skip to main content

Advertisement

Table 1 Primers and probes used for screening and identification of Plasmodium species

From: Molecular detection of human Plasmodium species in Sabah using PlasmoNex™ multiplex PCR and hydrolysis probes real-time PCR

Species Primer or probe Conc. [nM] Sequence (5’ → 3’) b References
Plasmodium spp. Plasmo1 200 GTTAAGGGAGTGAAGACGATCAGA [10]
Plasmodium spp. Plasmo2 200 AACCCAAAGACTTTGATTTCTCATAA
Plasmodium spp. Plasprobe 50 FAM-ACCGTCGTAATCTTAACCATAAA
CTATGCCGACTAG-BHQ-1
P. falciparum Fal-F primer 200 CCGACTAGGTGTTGGATGAAAGTGTTAA [10,12]
P. falciparum Falcprobea 80 Cy5-AGCAATCTAAAAGTCACCTCGAA
AGATGACT-BHQ-1
P. vivax Viv-F primer 50 CCGACTAGGCTTTGGATGAAAGATTTTA
P. vivax Vivprobea 80 TR-AGCAATCTAAGAATAAACTCCGA
AGAGAAAATTCT-BHQ-2
P. malariae Mal-F primer 50 CCGACTAGGTGTTGGATGATAGAGTAAA
P. malariae Malaprobe 50 FAM-CTATCTAAAAGAAACACTCAT-MGBNFQ
P. knowlesi Pkprobe 80 FAM-CTCTCCGGAGATTAGAACTCTTA [14]
GATTGCT-BHQ-1
Human β2M-F 900 TGAGTATGCCTGCCGTGTGA [15]
Human β2M-R 900 ACTCATACACAACTTTCAGCAGCTTAC
Human β2M-probe 100 FAM-CCATGTGACTTTGTCACAGCCCA
AGATAGTT-TAMRA
  1. aProbe sequence is as previously published [11], with modified fluorophores.
  2. bTAMRA, 6-carboxytetramethylrhodamine; MGBNFQ, minor groove binding nonfluorescent quencher; BHQ, black hole quencher; Cy5, cyanine; FAM, carboxyfluorescein; TR, Texas Red.