Skip to main content

Table 1 Primers for amplication on pvmsp - , pvmsp -3 β , pvmsp -1, and pvcsp genes

From: Genetic diversity of Plasmodium vivax population before elimination of malaria in Hainan Province, China

Gene Primers* Squencen(5′-3′) PCR cycling conditions**
pvcsp(N1) F:5′-ATGTAGATCTGTCCAAGGCCATAAA-3′ 95°C 3 min/[94°C 30 s, 58°C 30 s, 72°C 1.5 min] × 30 cycles, 72°C 5 min
R:5′-TAATTGAATAATGCTAGGACTAACAATATG-3′
pvcsp(N2) F:5′-CCAGATGACGAGGAAGGAGATGC-3′ 95°C 3 min/[94°C 30 s, 58°C 30 s, 72°C 1 min] × 35 cycles, 72°C 5 min
R:5′-TCTTTCACAGACTTTTCATTTGGG-3′
pvmsp-1(N1) F:5′-GAGCCCTACTACTTGATGGTCC-3′ 95°C 3 min/[94°C 30 s, 58°C 30 s, 72°C1min] × 35 cycles, 72°C 5 min
R:5′-CCTTCTGGTACAGCTCAATG-3′
pvmsp-(N1) F:5′-CAGCAGACACCATTTAAGG-3′ 95°C 3 min/[94°C 30 s, 54°C 30 s, 68°C 2.5 min] × 30 cycles, 68°C 5 min
R:5′-CCGTTTGTTGATTAGTTGC-3′
pvmsp-(N2) F:5′-GACCAGTGTGATACCATTAACC-3′ 95°C 3 min/[94°C 30 s, 55°C 30 s, 68°C 2.5 min] × 40 cycles, 68°C 5 min
R:5′-ATACTGGTTCTTCGTCTTCAGG-3′
pvmsp-3β(N1) F:GTATTCTTCGCAACACTC 95°C 3 min/[94°C 30 s, 54°C 30 s, 68°C 2.5 min] × 30 cycles, 68°C 5 min
R:CTTCTGATGTTATTTCCAG
pvmsp-3β(N2) F:CGAGGGGCGAAATTGTAAACC 95°C 3 min/[94°C 30 s, 55°C 30 s, 68°C 2.5 min] × 40 cycles, 68°C 5 min
R:GCTGCTTCTTTTGCAAAGG
  1. N1 = Nest 1 (Primary) reaction; N2 = Nest 2 (Secondary) PCR reaction.
  2. *F = Forward primer; R = Reverse primer. The reference sources of the primers are indicated.
  3. **The cycling conditions have been modified in the present work.
  4. The two columns indicate conditions for the primary and secondary amplification reaction.