Skip to main content

Advertisement

Table 1 Primers used for amplifications of pvcrt -o and pvmdr -1 marker genes

From: Polymorphisms in chloroquine resistance-associated genes in Plasmodium vivax in Ethiopia

Primers Sequences 5′ → 3′ Size (bp)
Pvmdr-1 (OF) CGCCATTATAGCCCTGAGCA 603
Pvmdr-1 (OR) TCTCACGTCGATGAGGGACT
Pvmdr-1 (NF) GGATAGTCATGCCCCAGGATTG
Pvmdr-1 (NR) CATCAACTTCCCGGCGTAGC
Pvcrt-o (OF) GCTACCCCTAACGCACAATG 253
Pvcrt-o (OR) GATTTGGGAAAGCAGAACGT
Pvcrt-o (NF) GATGAACGTTACCGGGAGTTGG
Pvcrt-o (NR) ATCGGAAGCATCAGGCAGGA
Pvcrt-o (Rseq) GGGGACGTCCTCTTGTATTT
  1. OF (Outer forward), OR (outer reverse), NF (nested forward), NR (nested reverse).