Skip to main content

Table 2 Primer sequences, exons targeted, and restriction enzymes used in the PCR-RFLP assay to detect two G6PD mutations

From: Glucose-6-phosphate dehydrogenase deficiency among malaria patients of Honduras: a descriptive study of archival blood samples

Variant Sequence (5´–3´) Exon Restriction enzyme References
A− (202 G>A, 376 A>G) GTGGCTGTTCCGGGATGGCCTTCTG AGGGCAACGGCAAGCCTTAC IV, V NlaIII [22, 35]
A+ (376 A>G) CTGCGTTTTCTCCGCCAATC AGGGCAACGGCAAGCCTTAC V FokI [22, 35]