Skip to main content

Advertisement

Table 1 Specific primers for msp1 and msp2 primer sets

From: Efficacy of artemether–lumefantrine therapy for the treatment of uncomplicated Plasmodium falciparum malaria in Southwestern Ethiopia

Locus Allele Primer Sequence (5′ to 3′) 
Forward Reverse
msp1 N/A   CTAGAAGCTTTAGAAGATGCAGTATTG
  CTTAAATAGTATTCTAATTCAAGTGGATCA
K1   AAATGAAGAAGAAATTACTACAAAAGGTGC
  GCTTGCATCAGCTGGAGGGCTTGCACCAGA
MAD20   AAATGAAGGAACAAGTGGAACAGCTGTTAC
  ATCTGAAGGATTTGTACGTCTTGAATTACC
  RO33   TAAAGGATGGAGCAAATACTCAAGTTGTTG
   CATCTGAAGGATTTGCAGCACCTGGAGATC
msp2 N/A   ATGAAGGTAATTAAAACATTGTCTATTATA
   ATATGGCAAAAGATAAAACAAGTGTTGCTG
FC27   GCAAATGAAGGTTCTAATACTAATAG
   GCTTTGGGTCCTTCTTCAGTTGATTC
3D7/IC   AGAAGTATGGCAGAAAGTAAKCCTYCTACT
   GATTGTAATTCGGGGGATTCAGTTTGTTCG
  1. All the primer sequences were adopted from Worldwide Antimalarial Resistance Network, WWARN (2005).