Skip to main content

Table 1 Primers and cycling condition of a nested PCR for amplifying pvmdr1

From: Evaluation of single nucleotide polymorphisms of pvmdr1 and microsatellite genotype in Plasmodium vivax isolates from Republic of Korea military personnel

  Primer name Sequence (5′–3′) Annealing temperature (°C) Size of PCR product (bp)
First pvmdr1 F1 TTGAACAAGAAGGGGACGTT 61 4290
pvmdr1 R1 CTTATATACGCCGTCCTGCAC
Second pvmdr1 F2 CAGCCTGAAAGATTTAGAAGCCTT 58 539
pvmdr1 R2 CATCCACGTCCACAGTGGAAC
pvmdr1 F3 GGATAGTCATGCCCCAGGATTG 62 604
pvmdr1 R3 CATCAACTTCCCGGCGTAGC
pvmdr1 F7 GATGAGCCTGCTGATGCGATTCTAC 60 745
pvmdr1 R5 ATATACGCCGTCCTGCACCGAG