Skip to main content

Table 1 Accession numbers and primer sequences of the genes studied

From: Enhanced artemisinin yield by expression of rol genes in Artemisia annua

S. no Gene name Primer sequences Accession no
1 psbA-trnH Forward: GTTATGCATGAACGTAATGCTC-3
Reverse: CGCGCATGGTGGATTCACAATC
FJ418749
2 Rol B Forward: GCTCTTGCAGTGCTAGATTT
Reverse: GAAGGTGCAAGCTACCTCTC
X15952.1
3 Rol C Forward: GAAGACGACCTGTGTTCTC
Reverse: CGTTCAAACGTTAGCCGATT
X64255.1
4 ADS Forward: ATTACTGGCGGTGCTAAC
Reverse: GTGCAGAGACAGCCCATT
JQ319661
5 CYP71AV1 Forward: ATTTTGGATATGTTTGGAGCAGGC
Reverse: TCCGCTTGTACTTTCTCCATTGCT
HQ315834
6 ALDH1 Forward: CAGGAGCTAATGGAAGTTCTAAGTCAG
Reverse: TTTCTTCCTTCGGCCACTGTTG
FJ809784
7 TFAR1 Forward: CCTTGGAGATCCTGAAGCTG
Reverse: CGTTGGATTGTGCTGAACTG
GU733320
8 Actin Forward: ATCAGCAATACCAGGGAACATAGT
Reverse: AGGTGCCCTGAGGTCTTGTTCC
EU531837
9 GADPH Forward: TGGGATCGTTGAGGGTCTT
Reverse: GCTGCTGGGAATAATGTTGAA
GQ870632.1