Skip to main content

Table 1 PCR/RFLP conditions used to identify the G6PD genetic variants of G6PDd unrelated individuals in the present study

From: Prevalence and molecular characterization of G6PD deficiency in two Plasmodium vivax endemic areas in Venezuela: predominance of the African A-202A/376G variant

Mutations identified by PCR/RFLPa Exon Primer oligonucleotide sequence (5′–3′) Amplicon sizeb (bp) References RFLP pattern (fragment size in bp)
REc Wild-type Mutantd
202G → A 4 GTGGCTGTTCCGGGATGGCCTTCTG
CTTGAAGAAGGGCTCACTCTGTTTTG
109 29 NlaIII 109 63, 46
376A → G 5 CAGTACGATGATGCAGC
CAGGTAGAAGAGGCGGT
90 FokI 90 58, 32
563C → T 6/7 ACTCCCCGAAGAGGGGT
CCAGCCTCCCAGGAGAGA
542 30 MboII 25, 26, 119,377 25, 26, 100, 119, 277
844G → C 8 GGAGCTAAGGCGAGCTC
CATGCTCTTGGGGACTG
230 NlaIII 11, 34, 75,110 11, 28, 47, 34,110
  1. RFLP restriction fragment length polymorphism analysis, bp base pairs, RE restriction endonuclease used for RFLP
  2. aThe remaining mutations located in the exons 4–8, specifically the 185C → A, 542A → T, 592C → T, 593G → C, 634A → G, 637G → T, 680G → A, 820G → A, 835A → T, 854G → A and 871G → A, were studied by DNA sequencing
  3. bCycling conditions used in the PCR were as follows: 40 cycles at 94 °C for 1 min, 60 °C (for exon 4 and 8) or 56 °C (for exon 5) or 58 °C (for exon 6/7) for 30 s, and 72 °C for 40 s. A final elongation at 72 °C for 7 min was added
  4. cRestriction endonuclease digestion carried out with 5 U of enzyme at 37 °C for 3 h
  5. d NlaIII, FokI or MboII recognition site is created by the mutation